ID: 1161465586

View in Genome Browser
Species Human (GRCh38)
Location 19:4428568-4428590
Sequence GGTGCTGGTGGGATTCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 1, 2: 0, 3: 27, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161465586_1161465590 -4 Left 1161465586 19:4428568-4428590 CCTGGATGAATCCCACCAGCACC 0: 1
1: 1
2: 0
3: 27
4: 170
Right 1161465590 19:4428587-4428609 CACCCTGCTGTGTGCGTCCATGG 0: 1
1: 0
2: 2
3: 41
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161465586 Original CRISPR GGTGCTGGTGGGATTCATCC AGG (reversed) Intronic
900231828 1:1562949-1562971 GGTGGTGCTGGGAGCCATCCTGG - Intronic
902378324 1:16040794-16040816 GATGCTGGCGGGATGCTTCCGGG - Intergenic
903279969 1:22244828-22244850 GGTGCTGGGGGGAGGCAGCCGGG + Intergenic
904622237 1:31782399-31782421 GGTTCTGGTGGGCAGCATCCAGG + Intergenic
906271378 1:44481790-44481812 TGTGCTGGTGGAAGTGATCCAGG + Intronic
911619144 1:100047385-100047407 TGTTCAAGTGGGATTCATCCAGG - Intronic
914926300 1:151891449-151891471 GCAGATGGTTGGATTCATCCAGG + Intronic
915022670 1:152796496-152796518 GGTGATGGTAGGAGTCATCCTGG + Intronic
918598700 1:186325832-186325854 GGTGGTGATGGGACTGATCCAGG - Exonic
920420817 1:205832142-205832164 GGTGCTGCTGGGATTGGTCTGGG + Intronic
922377358 1:224981826-224981848 GCTGGTGTTGGGATTCATGCAGG + Intronic
923633463 1:235671473-235671495 TGTCCCAGTGGGATTCATCCTGG - Intronic
1063899030 10:10712864-10712886 GGAGATGATTGGATTCATCCAGG - Intergenic
1067478704 10:46582029-46582051 GCTGCTGGTGGGCTTGATCAAGG + Exonic
1067616034 10:47759772-47759794 GCTGCTGGTGGGCTTGATCAAGG - Intergenic
1067776989 10:49171030-49171052 GGTCCTCGTGGGCTTCCTCCTGG - Intronic
1069784984 10:70982036-70982058 GGTGCTGTTGGGCCTCACCCAGG + Intergenic
1070644326 10:78190998-78191020 GGTGCTGGTGGAGGCCATCCAGG + Intergenic
1075572969 10:123558747-123558769 GCTGCAGGTGGGATTGAGCCAGG + Intergenic
1076139976 10:128070946-128070968 GGTGCCGGAGGCTTTCATCCTGG + Intronic
1076208665 10:128623443-128623465 TGTGCTGCTGGGACTCCTCCTGG - Intergenic
1076830590 10:132992391-132992413 GGTGCTGGTGGGATGCAGAGGGG + Intergenic
1079321601 11:19456095-19456117 GGAGCTGGTGGGAGCAATCCAGG - Intronic
1081106525 11:39077287-39077309 GATAATAGTGGGATTCATCCCGG + Intergenic
1083453570 11:62762907-62762929 GGTGCTGGTGTGATCCAGCCAGG + Exonic
1083668613 11:64288423-64288445 CCTGCTGGTGGGCTTCTTCCGGG + Exonic
1084898650 11:72293813-72293835 GGTCCTAGTGGGGTTCATACTGG + Intronic
1086497866 11:87422504-87422526 GGTGCTGGAGGCATTCACCATGG + Intergenic
1086874570 11:92079561-92079583 AGTTCCAGTGGGATTCATCCCGG + Intergenic
1089077990 11:115753994-115754016 GGTACTGGTGGTGTTCACCCTGG + Intergenic
1089561615 11:119346049-119346071 GCTGCTGGTGGCCATCATCCTGG - Exonic
1099488404 12:83256097-83256119 TGTGCTGGTGGAATTCCTCTGGG - Intergenic
1101691978 12:107091470-107091492 GAAGCTGTTGGCATTCATCCAGG - Intronic
1102997775 12:117362851-117362873 GGGGCTGGTGGCATTTCTCCAGG - Intronic
1103747466 12:123135197-123135219 GGTGAAGGTGGGATCCTTCCCGG + Intronic
1104411504 12:128561985-128562007 GGTGTTGGGGGGAGTGATCCAGG + Intronic
1111444702 13:88331978-88332000 GATGCTGCTGGCATTCAGCCAGG - Intergenic
1112071825 13:95861306-95861328 GCTGCTGATGGGGCTCATCCAGG + Intronic
1112322799 13:98422441-98422463 TGTGCTGGTGGTCTTCAACCTGG - Intronic
1113198016 13:107832481-107832503 GGTGCTTGTGGGATCCAACTGGG - Intronic
1114517547 14:23309482-23309504 GGTGGTGATGGGATTCCTCAAGG + Exonic
1116365082 14:44050251-44050273 GGTGGTGGTGGGAGTAATTCTGG - Intergenic
1119956511 14:78803953-78803975 GCTGCTGTTGGGTTTTATCCTGG - Intronic
1126411261 15:48375341-48375363 GGAGCTGGTGGGATTCTTACAGG - Intergenic
1127325842 15:57894605-57894627 GGTGATGATGGGAGTCATCAAGG - Intergenic
1128690703 15:69722756-69722778 TGAGCTGGTTGGATTCATGCAGG + Intergenic
1129116220 15:73366940-73366962 GGTGCAGGGGGTTTTCATCCCGG + Intronic
1129690839 15:77712444-77712466 GATGTTGGTTGGATTCATCCAGG - Intronic
1131983203 15:98016296-98016318 TATGCTGATGGGATTCATTCTGG - Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1133253067 16:4497357-4497379 GGTTCTGGTGGGATTTTTACAGG - Intronic
1134677634 16:16101837-16101859 GATGCTGGGTGGATTCTTCCTGG + Intronic
1137508843 16:49080627-49080649 GGGGTTTGTGGGATTCCTCCAGG - Intergenic
1139515698 16:67451221-67451243 GAGGCTGCTGGGATTCCTCCAGG + Intronic
1141268925 16:82521587-82521609 TGTGCAGGTTGGATTCAGCCTGG + Intergenic
1142418187 16:89954380-89954402 GGTGCTGGTGGGAGTCAGGGTGG + Intronic
1144708310 17:17384410-17384432 GCTGCATGTGGGATTCAGCCAGG - Intergenic
1146133502 17:30297967-30297989 GGTGCCTGTGGGATCCATGCTGG + Intergenic
1146269043 17:31472487-31472509 TGTGCGGCTGGGATTCATCCTGG - Intronic
1146415017 17:32623781-32623803 GGTGCTGGTGGCCCTCGTCCAGG + Intronic
1148963408 17:51412858-51412880 GGTGCTAGTGGGACTCAGGCGGG + Intergenic
1152067030 17:78117626-78117648 GGTGCTCGAGGGCTTCACCCTGG + Exonic
1152068635 17:78124601-78124623 GCTGCTGGTGGCCTTCATCATGG - Exonic
1152099831 17:78294558-78294580 GTTGCTGGTGGGATGCAGCTGGG + Intergenic
1153942590 18:9990752-9990774 GGTGTTGGTGGGGGTCAGCCTGG + Intergenic
1161366314 19:3881713-3881735 GGGGCTGGTGGGAGTGTTCCTGG + Intronic
1161428133 19:4215862-4215884 GGTGCTCGTGGGAGACATACAGG + Intronic
1161465586 19:4428568-4428590 GGTGCTGGTGGGATTCATCCAGG - Intronic
1163515785 19:17762827-17762849 GGAGCTGGCGGACTTCATCCGGG + Exonic
1163884015 19:19950151-19950173 GGAGCTGGTAGGATCCATACAGG - Intergenic
1166781979 19:45347760-45347782 CCAGCTGGTGGGATGCATCCTGG - Intronic
1167474598 19:49692403-49692425 GGTGCTGGTCGGTTTCCTTCCGG + Intronic
1168406981 19:56115640-56115662 GGTGCGGGTGGGAGGCATGCGGG - Intronic
925382202 2:3436730-3436752 GGTGATGGGGGTATTAATCCAGG - Intronic
925382223 2:3436798-3436820 GGTGATGGGGGGATTAATTCAGG - Intronic
925382246 2:3436865-3436887 GGTGGTGGGGAGATTAATCCAGG - Intronic
925382254 2:3436888-3436910 GGTGGTGGGGAGATTAATCCAGG - Intronic
925382262 2:3436911-3436933 GGTGGTGGGGGGATTAATCCAGG - Intronic
925382272 2:3436934-3436956 GGTGATTGGGGGATTAATCCAGG - Intronic
925382280 2:3436957-3436979 GGTGATTGGGGGATTAATCCAGG - Intronic
925382288 2:3436980-3437002 GCTGATGGGGGGATTAATCCAGG - Intronic
925382309 2:3437047-3437069 GGTGGTGGGGGGATTAATTCAGG - Intronic
925382319 2:3437070-3437092 GGTGATTGGGGGATTAATCCAGG - Intronic
925382327 2:3437093-3437115 GCTGATGGGGGGATTAATCCAGG - Intronic
925382348 2:3437160-3437182 GGTGGTGGGGGGATTAATTCAGG - Intronic
925382358 2:3437183-3437205 GGTGATTGGGGGATTAATCCAGG - Intronic
925382366 2:3437206-3437228 GGTGATGGGGGGATTAATCCAGG - Intronic
925382382 2:3437251-3437273 GGTGATTGGGGGATTAATCCAGG - Intronic
925382390 2:3437274-3437296 GGTGATGGGGGGATTAATCCAGG - Intronic
925382405 2:3437319-3437341 GGTGGTGGGGGGATTAATTCAGG - Intronic
925382415 2:3437342-3437364 GGTGATTGGGGGATTAATCCAGG - Intronic
925382423 2:3437365-3437387 GGTGATGGGGGGATTAATCCAGG - Intronic
925382438 2:3437410-3437432 GGTGGTGGGGGGATTAATTCAGG - Intronic
925382448 2:3437433-3437455 GGTGATTGGGGGATTAATCCAGG - Intronic
925382456 2:3437456-3437478 GGTGATGGGGGGATTAATCCAGG - Intronic
925382479 2:3437523-3437545 GGTGGTGGGGGGATTAATCCAGG - Intronic
925382489 2:3437546-3437568 GGTGATTGGGGGATTAATCCAGG - Intronic
925382497 2:3437569-3437591 GGTGATGGGGGGATTAATCCAGG - Intronic
925382513 2:3437614-3437636 GGTGATTGGGGGATTAATCCTGG - Intronic
925382521 2:3437637-3437659 GGTGATGGGGGGATTAATCCAGG - Intronic
925382537 2:3437682-3437704 GGTGATGGGGGGATTAATCCAGG - Intronic
925382546 2:3437705-3437727 GGTGATTGGGGGATTAATCCAGG - Intronic
925382554 2:3437728-3437750 GGTGATGGGGGGATTAATCCAGG - Intronic
925382570 2:3437773-3437795 GGTGATTGGGGGATTAATCCAGG - Intronic
925382578 2:3437796-3437818 GGTGATGGGGGGATTAATCCAGG - Intronic
925382594 2:3437841-3437863 GGTGATGGGGGGATTAATCCAGG - Intronic
925382618 2:3437908-3437930 GGTGGTGGGGGGATTAATCCAGG - Intronic
925382628 2:3437931-3437953 GGTGATTGGGGGATTAATCCAGG - Intronic
925382636 2:3437954-3437976 GGTGATGGGGGGATTAATCCAGG - Intronic
925382659 2:3438021-3438043 GGTGATGGGGGGATTAATCCAGG - Intronic
925382668 2:3438044-3438066 GGTGATTGGGGGATTAATCCAGG - Intronic
925382676 2:3438067-3438089 GGTGATGGGGGGATTAATCCAGG - Intronic
925382699 2:3438134-3438156 GGTGGTGGGGGGATTAATCCAGG - Intronic
925382709 2:3438157-3438179 GGTGATTGGGGGATTAATCCAGG - Intronic
925382747 2:3438266-3438288 GATGGTGGGGGGATTTATCCAGG - Intronic
925382856 2:3438571-3438593 GGGGATGGGGGGATTAATCCAGG - Intronic
926047503 2:9720557-9720579 GGTGGGGGTAGGATTCAGCCTGG + Intergenic
928620632 2:33084396-33084418 GCTGCTGGTGGGAGGCGTCCTGG + Intronic
929826738 2:45314777-45314799 TGTGCTGGTGGGAATGATTCAGG + Intergenic
931874635 2:66498536-66498558 GGAGGAGCTGGGATTCATCCTGG + Intronic
932215421 2:69963056-69963078 GGTACTGCTGGGATTCCGCCAGG - Intergenic
941918021 2:170824553-170824575 GGTGCTTCTGAGAGTCATCCAGG - Intronic
942115477 2:172725274-172725296 AGTGCTTGTGAGGTTCATCCAGG - Intergenic
945573655 2:211503351-211503373 AGTGCTGGTGGGACCCATCTTGG - Intronic
948738843 2:240029823-240029845 AGAGCTGGTGGATTTCATCCTGG - Exonic
948927800 2:241110636-241110658 GGTGCAGGGGGGATCCAACCTGG - Intronic
1170476075 20:16715758-16715780 TATGCTTGTGAGATTCATCCAGG + Intergenic
1172486629 20:35302275-35302297 GATGCTGGAGGGACTCACCCAGG + Intergenic
1172502830 20:35439113-35439135 GGTGGTGGTGGGGTACACCCTGG - Intronic
1172580209 20:36041473-36041495 TGTGCTGGTTGGATTCTTCTAGG - Intergenic
1172777259 20:37414904-37414926 GGTGCTGGTGAGAGCCATGCGGG - Intergenic
1172944862 20:38679179-38679201 GGTGCTGGCAGTTTTCATCCTGG + Intergenic
1174145111 20:48447892-48447914 GGGGCTTGTTGCATTCATCCAGG - Intergenic
1174424243 20:50420793-50420815 GGTGTTGCTGGGCTTCCTCCAGG - Intergenic
1175778706 20:61668881-61668903 GGTGCTGGTGGAAGGCACCCGGG - Intronic
1177876101 21:26633323-26633345 GGTGGTGATGGGAATCATCCTGG + Intergenic
1183934811 22:41256043-41256065 GGTGCTGGAGGGCTTCAACATGG - Exonic
950045120 3:9944549-9944571 TGTGCTGGAGGGCTTCATCAAGG + Exonic
952879309 3:37973427-37973449 GGGGCAGGTGGGAGCCATCCAGG - Intronic
953274029 3:41476999-41477021 GATGCTGTTGGGATGCATCTGGG + Intronic
954786370 3:53095794-53095816 GGTGCTGGTTGAATACATCAAGG + Intronic
962578758 3:136778404-136778426 GATGCTGGTGGGAGTCCTCATGG - Intergenic
963315612 3:143755202-143755224 GGGGCTGCTGGGGATCATCCTGG - Intronic
964579966 3:158222848-158222870 GATGCTGGTAGGAATTATCCAGG - Intronic
966824643 3:183953455-183953477 GCTGCTCCTGGGCTTCATCCTGG - Intronic
968815372 4:2818799-2818821 GGAGCTGGTGGGGTCCAGCCGGG + Intronic
969087443 4:4666984-4667006 GCTGATGGAGGTATTCATCCTGG - Intergenic
975088048 4:70366806-70366828 GGGGATGGTGGGATTCTCCCTGG - Exonic
976035140 4:80809502-80809524 TGTGCTAGAGGGATTAATCCTGG - Intronic
976518472 4:85999102-85999124 GGTGCTTGTGGGAAACTTCCAGG - Intronic
978486016 4:109254136-109254158 CTTGTTGGTGGGATTCATCAGGG - Intronic
981288370 4:143046061-143046083 GGTGCTGGTGTTTTTGATCCTGG - Intergenic
983653538 4:170056937-170056959 GGTCCTGGTGGTATTCAACATGG - Intergenic
991611951 5:68458581-68458603 GTTGCTGCTGGGCTCCATCCTGG + Intergenic
999790431 5:154934695-154934717 GGAGATGGTTGGATTCAGCCAGG - Intronic
1001956462 5:175851232-175851254 GGTGCTGGTGTGTTTCATTAAGG - Intronic
1002212179 5:177605607-177605629 GGGGATGGTGGGAGTCAGCCCGG - Intronic
1002580710 5:180208295-180208317 GGTGCTGGTGGAGCTCTTCCGGG - Intronic
1003255892 6:4474599-4474621 GGAGATGGTGGGCTTCATCCTGG - Intergenic
1006988928 6:38196516-38196538 GGTGCTGATGGGAGTCACCTTGG - Intronic
1007169083 6:39849898-39849920 CGTGCTGCTGGGAGTCACCCAGG - Intronic
1007237767 6:40403354-40403376 GGAGCTGGTGGGATTCAGTGAGG + Intronic
1007422929 6:41730371-41730393 GGTGCTGTAGGGATTAATCCAGG - Intronic
1007960229 6:45952134-45952156 GGTGGTGGTGGGTTTTTTCCTGG + Intronic
1017599341 6:156063513-156063535 TGTGCTCCTGGGATTCATCTCGG - Intergenic
1019420029 7:946480-946502 GGTGCTGCTGGGAGGGATCCAGG - Intronic
1021925148 7:25527075-25527097 TTTGCTGGTGGGGTTCTTCCTGG + Intergenic
1026177071 7:68007275-68007297 GGTGCTGGTGCTATCCATCTTGG + Intergenic
1031964074 7:128014837-128014859 GGAGCTGGTGGGATGGATACAGG - Intronic
1032243498 7:130186763-130186785 GGTGATGGTGGTGTTCATCATGG - Intronic
1032690854 7:134285107-134285129 GTTGCTGGGGGAATTGATCCTGG + Intergenic
1034338969 7:150340489-150340511 GGTGCTTGTGAAATTCCTCCAGG + Exonic
1035259906 7:157654342-157654364 GGTGCTGGTGGGAGTCAGGGTGG - Intronic
1035372391 7:158387689-158387711 GGTGCTGGATGGTCTCATCCAGG + Intronic
1035416673 7:158695111-158695133 GGTGCTGGGGTCATTCATCTGGG + Intronic
1038450828 8:27637806-27637828 GGTGCAGGGCGGATTCCTCCTGG - Intronic
1039887764 8:41664966-41664988 GGTGCTGCTGAGCTTCTTCCTGG - Intronic
1039891953 8:41691705-41691727 GGTGGAGATGGGATTTATCCAGG - Intronic
1042666599 8:71213671-71213693 GGTGCTGATGGGATTCATCCAGG - Intronic
1046286026 8:112093173-112093195 GGTCATGTTGGGATTCATCAAGG - Intergenic
1046720492 8:117613404-117613426 GATCCTGGTGGGATTCATTATGG - Intergenic
1048455332 8:134572942-134572964 TGTGCTTGTGAGATTCATCTAGG - Intronic
1049183212 8:141234205-141234227 GGTGCTGGTGGAAGGCAGCCTGG + Intronic
1049704393 8:144033988-144034010 CGTGCTGGCGGGATGCAGCCAGG + Intronic
1052707252 9:32008750-32008772 GGAGCTGGTGAGATTTCTCCTGG - Intergenic
1053062633 9:35043953-35043975 GATGCTGGTGGGACACATTCAGG - Exonic
1057276833 9:93680649-93680671 GGTCCTGGAGGGGTTCCTCCTGG - Intergenic
1058066327 9:100552507-100552529 GGTGCTTGTGGAACTCATCCAGG + Intronic
1058845429 9:108953249-108953271 GGTGGTGGTGTGATTTGTCCTGG - Intronic
1058861254 9:109119682-109119704 GGTGCTGGTCTACTTCATCCTGG - Exonic
1060471573 9:123952405-123952427 AGTGCTAGTGAAATTCATCCTGG - Intergenic
1061500990 9:131001763-131001785 GGTGCTGGTGGAATCCATGCTGG - Intergenic
1062689663 9:137834725-137834747 GGTGCCGGTGGGATTCGACTTGG + Intronic
1203794298 EBV:168253-168275 GGTGCGGGAGGGAGTCATCGTGG + Intergenic
1186343828 X:8670571-8670593 TGTGTTGCTGGGATTCTTCCAGG - Intronic
1189798910 X:44674002-44674024 GGTTCTAGTGGTGTTCATCCAGG - Intergenic
1195057949 X:101164855-101164877 TGTCCCAGTGGGATTCATCCCGG - Intergenic
1197404226 X:126029862-126029884 GGTGCTGGTGGGGTTGAGTCTGG + Intergenic
1202129845 Y:21599577-21599599 AAAGCTGGTGGGATTCAGCCTGG + Intergenic