ID: 1161465731

View in Genome Browser
Species Human (GRCh38)
Location 19:4429255-4429277
Sequence CTGAAGGGACAGATGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 865
Summary {0: 1, 1: 0, 2: 6, 3: 81, 4: 777}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161465731_1161465742 8 Left 1161465731 19:4429255-4429277 CCCTCCTCCATCTGTCCCTTCAG 0: 1
1: 0
2: 6
3: 81
4: 777
Right 1161465742 19:4429286-4429308 CCTGACCTTTCTTTGGGGACAGG 0: 1
1: 0
2: 1
3: 10
4: 170
1161465731_1161465740 3 Left 1161465731 19:4429255-4429277 CCCTCCTCCATCTGTCCCTTCAG 0: 1
1: 0
2: 6
3: 81
4: 777
Right 1161465740 19:4429281-4429303 ATGTTCCTGACCTTTCTTTGGGG 0: 1
1: 0
2: 0
3: 28
4: 276
1161465731_1161465738 1 Left 1161465731 19:4429255-4429277 CCCTCCTCCATCTGTCCCTTCAG 0: 1
1: 0
2: 6
3: 81
4: 777
Right 1161465738 19:4429279-4429301 CCATGTTCCTGACCTTTCTTTGG 0: 1
1: 0
2: 0
3: 17
4: 186
1161465731_1161465739 2 Left 1161465731 19:4429255-4429277 CCCTCCTCCATCTGTCCCTTCAG 0: 1
1: 0
2: 6
3: 81
4: 777
Right 1161465739 19:4429280-4429302 CATGTTCCTGACCTTTCTTTGGG 0: 1
1: 0
2: 1
3: 30
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161465731 Original CRISPR CTGAAGGGACAGATGGAGGA GGG (reversed) Intronic
900394305 1:2446868-2446890 CTGCAGGGGCAGGAGGAGGAAGG - Intronic
900485707 1:2921692-2921714 CTGGATGGACAGATGGACGGAGG - Intergenic
900485716 1:2921734-2921756 CTGGATGGACAGATGGACGGAGG - Intergenic
900485725 1:2921776-2921798 CTGGATGGACAGATGGACGGAGG - Intergenic
900485735 1:2921818-2921840 CTGGATGGACAGATGGACGGAGG - Intergenic
900485744 1:2921860-2921882 CTGGATGGACAGATGGACGGAGG - Intergenic
900498729 1:2989278-2989300 ATGAATGGATGGATGGAGGATGG - Intergenic
900555787 1:3279703-3279725 CTGAAGGGGATGGTGGAGGAAGG + Intronic
900787198 1:4656162-4656184 CTCCAGGGCCAGATGGAAGAGGG + Intronic
901129436 1:6953145-6953167 ACGACGGGACAGATGCAGGACGG - Intronic
901229301 1:7633140-7633162 CTGCAGGGACAAAGAGAGGACGG - Intronic
901315392 1:8304034-8304056 CTGAGTGGACAGAGGGAGGCAGG + Intergenic
901527914 1:9835685-9835707 CTGAAGGGGCAGCAGGAGGGAGG + Intergenic
901646008 1:10717072-10717094 CTGGAGGGACAGGAGCAGGAGGG + Intronic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
902363959 1:15958804-15958826 CTGAGGGGCCAGGTGGAGAAGGG + Intronic
902724650 1:18326718-18326740 AGGGAGGGACAGATGGAGGGAGG - Intronic
902777288 1:18682919-18682941 GTGCAGGGACAGGTGGAGAAGGG - Intronic
903260083 1:22126923-22126945 CTGGTGAGGCAGATGGAGGAAGG - Intronic
903321760 1:22547580-22547602 GGGAAGAGACAGATGGAGGCAGG - Intergenic
903331609 1:22599757-22599779 AAGAAGGGAGAGAGGGAGGAAGG + Intronic
903674240 1:25054390-25054412 AGGAAGGGAGGGATGGAGGAAGG - Intergenic
904326118 1:29727912-29727934 CTGTAGGGAGAGATGGGTGAGGG + Intergenic
904647394 1:31978069-31978091 CTGCAGGGGCAGATGGGAGATGG + Intergenic
904652016 1:32013271-32013293 CTGGAGGGAGAAATTGAGGAAGG - Intergenic
904703343 1:32372251-32372273 CTGAAGGCACAGAGGGATGTAGG - Intronic
904821921 1:33251103-33251125 CTGAAGGGACAGAAAGAACAGGG + Intergenic
905460668 1:38120846-38120868 CTGAAGGGGGTGATGGAGGGAGG - Intergenic
905596721 1:39214087-39214109 CTGAAGGCAGGGAGGGAGGAGGG - Intronic
905631696 1:39522380-39522402 CTGCAGGGACAGAAGGGGCAAGG - Intronic
905666057 1:39763792-39763814 CTGCAGGGACAGAAGGGGCAAGG + Exonic
906070899 1:43015723-43015745 ATGAAGGGAGAAATGGAGGAGGG - Intergenic
906794769 1:48688126-48688148 ATGAAGGGAGAGAAGGAGGGAGG + Intronic
907224016 1:52927911-52927933 CTGGAGGGACAGAGGGAGGCCGG - Intronic
907306250 1:53514651-53514673 CAGAGGGGACAGATGGTGGTGGG + Exonic
907313603 1:53553851-53553873 CAGAACGGGCAGGTGGAGGATGG + Intronic
907389598 1:54149617-54149639 CTAAAGGGAGAGAAGGAGCATGG - Intronic
907850047 1:58247749-58247771 GAGAAGGGAGAGATGCAGGAAGG - Intronic
907919763 1:58901673-58901695 ATGAGTGGACAGATGGATGATGG - Intergenic
907966649 1:59337340-59337362 CAAAAGGGAGAGAGGGAGGAAGG + Intronic
909007692 1:70296760-70296782 CTGAAGGGAGGGATAGAAGAAGG + Intronic
909288733 1:73854915-73854937 CGGGAGGGAGAGAGGGAGGAAGG + Intergenic
909343562 1:74558605-74558627 CAGAAGGGACAGAAGGGAGAAGG - Intergenic
909921128 1:81381466-81381488 CTCAAGGGACAGAGGCGGGAAGG + Intronic
909926655 1:81445550-81445572 CTGAAGGGACTTAGAGAGGACGG + Intronic
910499392 1:87872111-87872133 ATGAAGGGAAAGAGAGAGGATGG - Intergenic
911519271 1:98909103-98909125 AAGGAGGGACAGAGGGAGGAAGG + Intronic
911532001 1:99054061-99054083 GTGTATGGACAGATGGGGGAAGG - Intergenic
912364033 1:109118216-109118238 CAGTAGGCAGAGATGGAGGAAGG + Intronic
912484541 1:110015016-110015038 CTGAATGGAAAGGTGGGGGAAGG + Intronic
912567372 1:110597940-110597962 CAGCAGGGACAGATGGAGGTAGG - Intronic
912582667 1:110734606-110734628 GGGAAGGGGGAGATGGAGGACGG - Intergenic
912759529 1:112354719-112354741 AAGAAGGGAGAGGTGGAGGAAGG - Intergenic
912779560 1:112532501-112532523 CTTAGGGGACAGTTGGAGAAGGG - Intronic
913316977 1:117561769-117561791 CAGAAGCCAAAGATGGAGGATGG + Intergenic
913385349 1:118252974-118252996 TTGAAGGGAAAGAGGGAGGAAGG - Intergenic
913530174 1:119728377-119728399 CTGGAAGGACAGATGGACAATGG - Intronic
915318866 1:155045019-155045041 CTGAAAGGACAGCTGGCGGGAGG + Intronic
915545650 1:156595913-156595935 CTGCAGGGAAAGTTGGTGGAGGG + Intronic
915895343 1:159807576-159807598 CTGAGGGTAGAGATGGAGGCTGG + Intronic
916841950 1:168609862-168609884 CTGAGGAGACAGAGGGGGGAGGG + Intergenic
917303605 1:173604781-173604803 CTGAGGGGACAGCAGTAGGATGG - Intergenic
919325402 1:196100400-196100422 CTGAAAGGAAAGATGAAGGCTGG + Intergenic
920355160 1:205366587-205366609 CTGAAAGGAAAAAGGGAGGATGG - Intergenic
920364254 1:205439841-205439863 ATGAAGGGAGAGAGGAAGGAAGG + Intronic
920496317 1:206457402-206457424 CTGAAGGTACAGAGGAGGGAGGG + Intronic
920673185 1:208020386-208020408 TTGAGGGGACAGATGGCGGTGGG + Intergenic
920910031 1:210207674-210207696 AGGGAGGGACAGAGGGAGGAAGG + Intergenic
921055310 1:211538513-211538535 CAGAAGGGGCAGATGGGGGAGGG + Intergenic
921303018 1:213768412-213768434 AGGAAGGGAGAGAGGGAGGAAGG + Intergenic
921681597 1:218039488-218039510 CTGAGGGATCAGATGGAGGTTGG + Intergenic
921771885 1:219050405-219050427 AAGAAGGGAGAGAAGGAGGAAGG + Intergenic
922215936 1:223520027-223520049 CTAAAGGTACACATGGAGGAAGG - Intergenic
922614168 1:226951351-226951373 CTGAAGCGACAGGAGGAGGGAGG + Intronic
922700128 1:227754432-227754454 ACGGATGGACAGATGGAGGAAGG - Intronic
922790877 1:228310262-228310284 ATGAATGGACAGATGATGGATGG - Intronic
922822536 1:228494147-228494169 CTGCCGGGACTCATGGAGGATGG - Exonic
923093483 1:230756975-230756997 AGGAAGGGAGAGAGGGAGGAAGG + Intronic
923110414 1:230885510-230885532 TTGAAGGGACAGAGGGTGGGAGG - Intergenic
923153829 1:231258348-231258370 TAAAAGGGACAGATGGAAGAAGG - Intronic
923232460 1:231999734-231999756 CTGAAGGGGCAGAAGGCAGAAGG - Intronic
923258275 1:232241294-232241316 ATGAAGGGCCACATGGAAGATGG - Intergenic
923344594 1:233039246-233039268 GGGAAGGAACAGAGGGAGGAAGG - Intronic
924113036 1:240718577-240718599 GTGAAGGGAGGGAGGGAGGAAGG - Intergenic
924486564 1:244489517-244489539 CTGAAGAGACAGCTGGAGTCAGG + Intronic
924499855 1:244627146-244627168 CTGAGGGGAGAGATGCGGGATGG + Intronic
1063017777 10:2095704-2095726 GTGGAGGGACAGAGAGAGGATGG + Intergenic
1063698022 10:8356517-8356539 AGGAAGGGAGAGAGGGAGGAAGG - Intergenic
1063702872 10:8402466-8402488 CTGAAGGGACACAGGGCGAAAGG + Intergenic
1064587395 10:16852264-16852286 AGGAAGGGAAAGATGGAGGGAGG - Intronic
1064741540 10:18439788-18439810 CAGAAGGGAGGGAGGGAGGAAGG - Intronic
1065441858 10:25761316-25761338 CTGAAATTACAGATGGAGGCTGG + Intergenic
1065630608 10:27677029-27677051 CTGAAGGGAAAGATGTAGGGTGG + Intronic
1065746811 10:28849490-28849512 CTGCAGGGATGGATGGAGGTAGG + Intronic
1065766642 10:29036543-29036565 CAGAAGGAACAGAAGCAGGAAGG + Intergenic
1065819751 10:29514752-29514774 CTGATGTGACAGATATAGGAGGG - Intronic
1066489702 10:35882857-35882879 CTGGAGGGACAGATGCAGACAGG + Intergenic
1066504068 10:36023787-36023809 CTGAAGGAAGAGAAGGAAGAAGG - Intergenic
1067794837 10:49313388-49313410 ATGAGGGGAAAGATGGAGCAAGG + Intronic
1067893970 10:50160135-50160157 GTGAAAGGAGAGATGGAGGAAGG - Intergenic
1067954877 10:50780129-50780151 GTGAAAGGAGAGATGGAGGAAGG + Intronic
1068117661 10:52752076-52752098 CTGACAGGACATATGGAGGCTGG - Intergenic
1068526636 10:58138014-58138036 CTGAAGGGATAGGGAGAGGAAGG + Intergenic
1068667790 10:59695835-59695857 CTTTAGGTACATATGGAGGAAGG + Intronic
1069247353 10:66222662-66222684 AGGAAGGGAGGGATGGAGGAAGG + Intronic
1069281689 10:66662583-66662605 CAGAAAGGACAGAGGAAGGAAGG - Intronic
1069854407 10:71431847-71431869 CTGCAGGGAGAGATGGGAGATGG + Intronic
1070332592 10:75429083-75429105 TAGAAGGAACAGAAGGAGGAAGG - Intergenic
1070363620 10:75714806-75714828 AGGAAGGGAAAGAAGGAGGAAGG - Intronic
1070456833 10:76625381-76625403 CTAAAAGGACAGAGTGAGGAGGG + Intergenic
1070976251 10:80608281-80608303 CTGAAGGCACAGAGGGCGGGAGG + Intronic
1071122732 10:82298265-82298287 AGGAAGGGAGAGAGGGAGGAAGG + Intronic
1071160476 10:82740139-82740161 AGGAAGGGAAAGAGGGAGGAAGG - Intronic
1073070182 10:100788371-100788393 CTGGAGGGGCAGTGGGAGGAGGG + Intronic
1073293569 10:102425199-102425221 CTGAAGGGACACAGACAGGATGG + Intronic
1073443168 10:103564767-103564789 CAGAGGGGACAGCTGGAGGTGGG - Intronic
1073467264 10:103701428-103701450 ATGAATGGATAGATGGTGGATGG - Intronic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1074375628 10:112938814-112938836 CTGAAGGGACAGGGAGAGGAGGG + Intergenic
1074913652 10:117935629-117935651 TGTAAGGGACAGAGGGAGGAAGG - Intergenic
1074931199 10:118127939-118127961 AAGAAGTGACAGATGGAGGAAGG - Intergenic
1075559523 10:123458459-123458481 AAGAAGGGAAAGAGGGAGGAAGG - Intergenic
1076281139 10:129247308-129247330 GTGACGGGAAAGCTGGAGGAGGG - Intergenic
1076444972 10:130508041-130508063 CAGAAAAGACAGATGGATGAGGG - Intergenic
1076471533 10:130722115-130722137 CTGAAGGCAAGGATGGAGGGAGG + Intergenic
1076558705 10:131346999-131347021 ATGAAGGGAGGGAGGGAGGAAGG - Intergenic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1077015992 11:399409-399431 CAGAGGGGGCAGGTGGAGGAGGG - Intronic
1077016021 11:399482-399504 CAGAGGGGGCAGGTGGAGGAGGG - Intronic
1077280503 11:1742895-1742917 ATGGATGGACAGATGGAGGATGG + Intronic
1077280515 11:1742952-1742974 GAGGATGGACAGATGGAGGATGG + Intronic
1077280556 11:1743142-1743164 ATGGATGGACAGATGGAGGATGG + Intronic
1077280576 11:1743274-1743296 ATGGATGGACAGATGGAGGATGG + Intronic
1077280591 11:1743354-1743376 GAGGATGGACAGATGGAGGATGG + Intronic
1077280616 11:1743486-1743508 ATGGATGGACAGATGGAGAATGG + Intronic
1077610131 11:3638923-3638945 CTGAAGGGAAAAGAGGAGGAAGG + Intronic
1077868412 11:6241364-6241386 CTGAAGGAAGGGATGGAGGCAGG + Intronic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1077898590 11:6473112-6473134 CTGCAGGGACAGATGGTTGCAGG - Intronic
1078050361 11:7960500-7960522 CTGCAGGGGCAGATGGAGAGAGG - Exonic
1078076531 11:8166928-8166950 AGGGAGGGACAGAGGGAGGAAGG + Intronic
1078264998 11:9748642-9748664 CTGAAGGGACACGAGGAGGGAGG - Intronic
1078603234 11:12751604-12751626 CTGAAGGGACAGGGGTGGGAGGG + Intronic
1079964399 11:26963213-26963235 CAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1080336445 11:31202906-31202928 CTGAGGGGATGGATGGAGGGTGG + Intronic
1081641274 11:44755975-44755997 ATGGAGAGAGAGATGGAGGAGGG + Intronic
1081758290 11:45559959-45559981 GTGAAGGAAGAGATGGAAGAAGG - Intergenic
1083592234 11:63902581-63902603 CTGCTGGGCCAGAGGGAGGATGG - Exonic
1083815770 11:65131597-65131619 CTGAAGGGAGAGGGGGACGAGGG + Intronic
1084101870 11:66955205-66955227 CTGAGAGGACAGAGGGAAGAGGG + Intronic
1084443929 11:69192548-69192570 CCGAGGGGACACATGGAGCAGGG - Intergenic
1084740004 11:71133410-71133432 ATGGATGGACAGATGGAGGGAGG + Intronic
1084900676 11:72307770-72307792 CTGAAGGGCCATTTGGTGGATGG + Intronic
1085331135 11:75652368-75652390 CAGAAGGGACAGCTGGGGCATGG - Intronic
1085406894 11:76268761-76268783 ATGAATGGATGGATGGAGGATGG - Intergenic
1085460013 11:76687920-76687942 CTGAAGGGACAGACTGGGGCAGG + Intergenic
1085508607 11:77074071-77074093 CTTAGGGAGCAGATGGAGGATGG + Intronic
1085695954 11:78704960-78704982 CTGCAGGGACAGAGGGAGCTGGG - Intronic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1086226037 11:84510915-84510937 ATACAGGGACAGAGGGAGGAGGG + Intronic
1086370691 11:86152647-86152669 CTAGAGTGACAGGTGGAGGAAGG - Intergenic
1086918339 11:92557140-92557162 CAGAAGGTGAAGATGGAGGAGGG - Intronic
1087180129 11:95133817-95133839 CTGAAGGTACAGATGAGGGTTGG + Intergenic
1087424517 11:97970515-97970537 CTGAAGGTGCAGTTGGAGGAAGG + Intergenic
1088822756 11:113470537-113470559 CTGAAGGGACAGGGAGGGGAAGG - Intronic
1088935807 11:114399544-114399566 GTGAAGGGGGAGATGGAAGATGG + Intronic
1089890052 11:121871749-121871771 CTGAAGGGAAAGAATGAGCAAGG + Intergenic
1089958759 11:122597249-122597271 ATGGAGGGAGGGATGGAGGAAGG + Intergenic
1090033952 11:123231903-123231925 CTGAAGTGACTGATGGAGGCAGG - Intergenic
1090387583 11:126365711-126365733 CTGGTGGGGCAGCTGGAGGAAGG + Intronic
1090390149 11:126382909-126382931 CTGGCGGGGCAGCTGGAGGAAGG + Intronic
1090716509 11:129436616-129436638 AAGGAGGTACAGATGGAGGAAGG - Intronic
1090758072 11:129812541-129812563 CTCAAGGGAAAGTGGGAGGAGGG + Intergenic
1090961968 11:131565176-131565198 GTGAAGGGTCAGCTGCAGGAAGG - Intronic
1091153143 11:133348008-133348030 CTGAAGGGTCAGATGTAACAGGG - Intronic
1091616032 12:2052321-2052343 TAGAAGTGACAGATAGAGGAGGG - Intronic
1091654244 12:2333661-2333683 CTGCAGAGAGAGATGGAGGTTGG + Intronic
1091755867 12:3051153-3051175 CTGAAAGGAAGGAAGGAGGAAGG - Intergenic
1092139423 12:6172506-6172528 CTGAAGTTCCAGAGGGAGGAAGG + Intergenic
1092629267 12:10361072-10361094 TTGTAGAGACAGAGGGAGGAGGG + Intergenic
1092889595 12:12956296-12956318 AGGAAGGGACAGAGGGAGGAAGG - Intergenic
1093472911 12:19524025-19524047 AGGGAGGGAGAGATGGAGGAAGG - Intronic
1094125519 12:27018878-27018900 CAGGAGGGAGAGAAGGAGGAAGG + Intergenic
1094136778 12:27136106-27136128 ATGAAGGAAGAGGTGGAGGATGG + Intergenic
1094186516 12:27648863-27648885 ATGAAGGGAGAGGTGGAGGATGG + Intronic
1094563653 12:31579744-31579766 GGGAAGGGAGAGAGGGAGGAAGG + Intronic
1095174136 12:39071264-39071286 CTGAAAAGACAGATCCAGGATGG - Intergenic
1095365426 12:41398429-41398451 GTGAAGGGAAAGAAGTAGGAAGG + Intronic
1096413889 12:51396218-51396240 TTGAAGGGAGGAATGGAGGAAGG - Intronic
1096975545 12:55697516-55697538 CTCATGGGAGACATGGAGGATGG + Exonic
1097131350 12:56812992-56813014 ATGAAGGGACAAAGGAAGGAAGG - Intergenic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1097945892 12:65366958-65366980 CTTAAGGGACAGGAGGAGGAGGG + Intronic
1098052340 12:66467699-66467721 CTTAAGGAACAGAAGGATGATGG - Intronic
1099904596 12:88757213-88757235 AAGAAGGGAGAGAGGGAGGAGGG - Intergenic
1100471250 12:94895214-94895236 CAGAAGGGAGAGAGGGAGCAAGG - Intergenic
1100545948 12:95602513-95602535 CTGAACTGATAGATGGATGATGG + Intergenic
1100765947 12:97865820-97865842 CTGGGGGGATAGATTGAGGAGGG - Intergenic
1100785532 12:98074022-98074044 CTGCAGGGAGAGATGGTGAAGGG - Intergenic
1101874528 12:108589715-108589737 GTGAAGGGACAGATTGATGTGGG - Intergenic
1102452710 12:113053725-113053747 AGGAAGGGAGAGATGGAGGAAGG + Intergenic
1103030245 12:117606760-117606782 ATGAAGGGAGGGAAGGAGGAAGG - Intronic
1103905447 12:124325258-124325280 CTGGACGGACAGATGGATGGAGG + Exonic
1104056461 12:125234562-125234584 CTGAAGGGACCGAGGGGGGTTGG - Intronic
1104274078 12:127308906-127308928 CGGAAGGGACTGATGGAGCCTGG - Intergenic
1104425681 12:128675716-128675738 GTGGGTGGACAGATGGAGGAAGG + Intronic
1104668851 12:130666976-130666998 AGGGAGGGACAGAGGGAGGAAGG + Intronic
1104715429 12:131013082-131013104 CTGAAGGGCAAGATTGAAGAAGG - Intronic
1104807551 12:131599113-131599135 CTGATGGGAAAGATGCAGGGAGG - Intergenic
1105042342 12:132970295-132970317 CTGAAGGGACCGAAGGTGGTTGG + Intergenic
1105208949 13:18246723-18246745 CAGAGGGGAGAGATGGAGGCAGG + Intergenic
1106065858 13:26348541-26348563 GGGAAGGGGCAGATGGTGGATGG - Intronic
1107088643 13:36452106-36452128 AGGAAGGGACAGAGGGAGGGAGG - Intergenic
1107400726 13:40066466-40066488 AAGAAGGGACAGAGGGAGGGAGG + Intergenic
1107462412 13:40616845-40616867 CAAAAGGGACAGATGGAGAAAGG + Intronic
1107630020 13:42333728-42333750 ATGAGGGAAGAGATGGAGGAGGG + Intergenic
1107710102 13:43142939-43142961 CTGAAGGCAGAGATGTAGGAAGG + Intergenic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1109747275 13:66641704-66641726 ATGAAGGGACAGATAGATGATGG + Intronic
1110458078 13:75712250-75712272 CTGAAGTGGCAGGTGGAGCAGGG + Intronic
1110704874 13:78594050-78594072 GAGAAGGGAAAGATGGAGGTAGG + Intergenic
1110706909 13:78607704-78607726 CTGAAGGGTGGAATGGAGGAAGG + Intergenic
1110810934 13:79809875-79809897 CTGAAGGATGAGATGAAGGAAGG - Intergenic
1111452600 13:88438685-88438707 AGGGAGGGACAGAGGGAGGAAGG + Intergenic
1112170784 13:96969802-96969824 CTGAAAGGGCAGACTGAGGAGGG + Intergenic
1112306031 13:98274404-98274426 CAGAAGAGACTGAGGGAGGAAGG + Intronic
1113049981 13:106200138-106200160 ATGGAGGGACAGAGGGAGGGAGG - Intergenic
1113471548 13:110550261-110550283 ATGAAGAGACACATGGAGCAAGG - Intronic
1114128810 14:19764392-19764414 CTGAAGGGACTGAGAGAGGGAGG + Intronic
1114555766 14:23561436-23561458 CAGAAGGGACAGAAGGGGCAGGG + Intronic
1114574864 14:23703025-23703047 CAGCAAGGACAGTTGGAGGAAGG + Intergenic
1115084274 14:29494510-29494532 AGGAAGGGAGAGATGGAGGGAGG + Intergenic
1115791227 14:36880978-36881000 CAGAAGGGACACATTGAGAAAGG + Intronic
1116201977 14:41808516-41808538 AGGAAGGGAGGGATGGAGGAAGG + Intronic
1116644176 14:47505210-47505232 GGGAAGGGAAAGATGGAGAAAGG + Intronic
1117513920 14:56481523-56481545 AGGAAGGGAGGGATGGAGGAAGG + Intergenic
1117531027 14:56661012-56661034 CTGAAGGAAAAGCTGGAGGCGGG + Intronic
1118008413 14:61586066-61586088 CAGAAGGCAGAGAGGGAGGAAGG - Intronic
1118730801 14:68664974-68664996 CTGAAAGGACAGAAGGAACATGG - Intronic
1118929372 14:70225783-70225805 CTTAAGGGACAGATAAGGGAAGG + Intergenic
1119609233 14:76047704-76047726 GGGAAGGAACAGAGGGAGGAAGG - Intronic
1120005692 14:79355268-79355290 TTGGAGGGACAGAGGAAGGAGGG - Intronic
1121423210 14:93830168-93830190 ATGGATGGATAGATGGAGGAAGG + Intergenic
1121556157 14:94839364-94839386 CTGATGGGAGGGAAGGAGGAAGG - Intergenic
1121613104 14:95294530-95294552 CGGAAGGGACAGGTGAGGGAGGG - Intronic
1121741813 14:96257930-96257952 AGGAAGGGAGGGATGGAGGAAGG + Intronic
1121800190 14:96768628-96768650 TGGAAGGGAGAGAGGGAGGAAGG - Intergenic
1122233708 14:100320385-100320407 ATGGAGGGACGGATGGAGGAGGG - Intergenic
1122355091 14:101118162-101118184 CTGGAAGGAGAGATGGAGGGAGG - Intergenic
1122600892 14:102921282-102921304 CTGAATGGATGGATGGTGGATGG - Intergenic
1122631236 14:103108712-103108734 CTGGTGGGGCTGATGGAGGATGG - Intronic
1122812973 14:104298038-104298060 ATGCAGGGGCAGGTGGAGGAAGG - Intergenic
1123571758 15:21618604-21618626 CTGAAGGGACTGAGAGAGGGAGG + Intergenic
1123608374 15:22061200-22061222 CTGAAGGGACTGAGAGAGGGAGG + Intergenic
1123759591 15:23422205-23422227 CTGAACGAACAGATGAATGAGGG + Intergenic
1125200072 15:37095431-37095453 CTCTAGGGAGAGAGGGAGGAAGG - Intronic
1126688883 15:51272152-51272174 CTGAAGGGAAAAATCGAAGATGG - Intronic
1126849490 15:52788709-52788731 CCGAAGGGACCAAAGGAGGAAGG - Intronic
1127068586 15:55265794-55265816 CTGAAGGGATGCATGGAGGTAGG + Intronic
1127330200 15:57931606-57931628 AAGAAGGGAAAGATGGAGGAAGG - Intergenic
1127330206 15:57931650-57931672 AAGAAGGGAGAGATGGAGGAAGG - Intergenic
1127745816 15:61971064-61971086 TTGAAGGGATAGATGGAATATGG + Intronic
1127764017 15:62166984-62167006 CTGAGTGAATAGATGGAGGAAGG - Intergenic
1128358298 15:66943549-66943571 CTGAAGGGAAAGAAGAGGGAGGG - Intergenic
1128524935 15:68406012-68406034 CTGCTGGGTCAGATGCAGGAAGG - Intronic
1129117296 15:73371668-73371690 GGGCAGGCACAGATGGAGGAAGG + Intergenic
1129295808 15:74599457-74599479 CTGAAGGCGCAGATGGAGGGAGG + Intronic
1129685144 15:77681743-77681765 ATGAGGGGACAGGTGGAGGGAGG + Intronic
1129690886 15:77712662-77712684 GTGATGGGTCACATGGAGGAAGG - Intronic
1129883914 15:79025632-79025654 CTGCAGGGCCAGATGGCTGAGGG + Intronic
1130381041 15:83372678-83372700 GTGAAGGGACTGAGGCAGGAGGG - Intergenic
1130527705 15:84721524-84721546 CTGCAGGGACAGCTGTAAGAGGG + Intergenic
1130558364 15:84939359-84939381 AGGAAGGGACAGAGGGAGGGAGG + Intronic
1130783130 15:87066132-87066154 CTGAAGGGATAGATGGGGGCTGG + Intergenic
1131161824 15:90110366-90110388 ATGGAGGGAGAGAGGGAGGAAGG + Intergenic
1131833211 15:96367264-96367286 CCGGAGGGAGAGCTGGAGGAAGG - Intergenic
1131863038 15:96674972-96674994 CTGAAGGAACAGAGGGAAGGAGG + Intergenic
1132030864 15:98437755-98437777 ATGAATGGATGGATGGAGGATGG + Exonic
1132226997 15:100150571-100150593 GAGGAGGGACAGAGGGAGGAAGG - Intronic
1132398439 15:101490195-101490217 CTGAAGGGACACATTGAGCGGGG + Intronic
1202980613 15_KI270727v1_random:352999-353021 CTGAAGGGACTGAGAGAGGGAGG + Intergenic
1133326833 16:4947077-4947099 ATGAATGGATGGATGGAGGAAGG - Intronic
1133863567 16:9619845-9619867 CTGAAGGAAGAGCTGGAGCATGG - Intergenic
1134287978 16:12879120-12879142 ATGGAGGGAGAGAAGGAGGAAGG - Intergenic
1134404697 16:13946154-13946176 CAGAAGTGAAAGATGGAGGCAGG - Intronic
1134570399 16:15285581-15285603 AGGAAGGGAGGGATGGAGGAAGG + Intergenic
1134682381 16:16135311-16135333 AAGTGGGGACAGATGGAGGAGGG - Intronic
1134731978 16:16470472-16470494 AGGAAGGGAGGGATGGAGGAAGG - Intergenic
1134911036 16:18026614-18026636 AGGAAGGGACAGAGGGAGGGAGG - Intergenic
1134935460 16:18241493-18241515 AGGAAGGGAGGGATGGAGGAAGG + Intergenic
1135007497 16:18839592-18839614 CTGGAGGGACAGAGGAAGGAAGG + Intronic
1135155719 16:20051143-20051165 CTGAAGGGACACAAGGTGGGAGG + Intronic
1135510349 16:23077575-23077597 AGGTAGGGAGAGATGGAGGAGGG - Intronic
1135806462 16:25547268-25547290 AAGAAGGGCCAGATGGAGGGAGG - Intergenic
1136065452 16:27755323-27755345 CAGAAGGCAGAGATGGAGCAGGG - Intronic
1136268016 16:29132144-29132166 AAGAAGGGAGAGAGGGAGGATGG + Intergenic
1136367165 16:29814177-29814199 GTGAAGGGGCAGGGGGAGGAGGG - Intronic
1136450941 16:30353980-30354002 CTGCAGGAGGAGATGGAGGAAGG - Exonic
1136477303 16:30521513-30521535 CTGAAGGAGAAGATGGAGGCTGG + Exonic
1137579912 16:49627465-49627487 ATGAATGGGTAGATGGAGGATGG - Intronic
1137687866 16:50399417-50399439 CTGTAATGACAGATGGTGGAGGG + Intergenic
1137919361 16:52471622-52471644 TTGAAGGGAGAGAGGGAGAAAGG + Intronic
1138458838 16:57136077-57136099 AGGAAGGGAGGGATGGAGGAAGG + Intronic
1138495765 16:57408309-57408331 GTGAATGGATGGATGGAGGATGG - Intronic
1139532457 16:67549057-67549079 CTGAGGGGACAGATGGAAGTGGG + Intergenic
1139766903 16:69238170-69238192 TTGGAGGGAAAGAAGGAGGAGGG + Intronic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140830370 16:78745301-78745323 TTGAAGGCAGAGGTGGAGGAAGG - Intronic
1140914668 16:79483088-79483110 AAGTAGGGACAGAGGGAGGAAGG - Intergenic
1141017597 16:80465213-80465235 CTCAAGGAAGGGATGGAGGAAGG - Intergenic
1141283390 16:82649300-82649322 ATGAATGCATAGATGGAGGATGG + Intronic
1141427126 16:83951837-83951859 AGGAAGGGAAAGAGGGAGGAAGG - Intronic
1141619786 16:85231001-85231023 ATGGATGGACAGATGGATGATGG + Intergenic
1141619820 16:85231182-85231204 ATGGATGGACAGATGGATGATGG + Intergenic
1141619847 16:85231335-85231357 ATGGATGGACAGATGGATGATGG + Intergenic
1141742799 16:85905211-85905233 CTGAAGGCACAGTTGCAGGTTGG + Intronic
1141842651 16:86584049-86584071 CTGAGGGGGCAGAGGCAGGATGG - Intergenic
1142244718 16:88964783-88964805 CTGGATGGATAGATGGTGGATGG - Intronic
1142323303 16:89398961-89398983 CTGATGGGAGAGAGGGATGATGG - Intronic
1142661843 17:1435866-1435888 AGGAAGGGAGAGAGGGAGGAAGG + Intronic
1143284912 17:5781744-5781766 CTGCAGGTACAGGTGGAGGATGG + Intronic
1143284935 17:5781868-5781890 ATGCAGGTACAGGTGGAGGATGG + Intronic
1143284952 17:5781958-5781980 ATGCAGGTACAGGTGGAGGATGG + Intronic
1143520554 17:7441923-7441945 CTCAAGGGACAAATTGAGGAAGG - Intronic
1144807167 17:17975771-17975793 CGGAAGGCACAGGTGGAGAAGGG + Intronic
1144865111 17:18330610-18330632 CCAAAGGCACAGATGGTGGAAGG - Exonic
1145416493 17:22717501-22717523 GGCAAGGGACAGAGGGAGGAAGG - Intergenic
1146000919 17:29129828-29129850 CTGAAGGGATAGAGAGAGTAAGG + Intronic
1146626877 17:34441706-34441728 CTGGATGGACAGATGGATGGAGG + Intergenic
1147632000 17:41938288-41938310 CAGAAGGGGCAGCTGGTGGATGG - Intronic
1148192608 17:45690134-45690156 CTGAAGGGGAAGGAGGAGGAAGG + Intergenic
1148778528 17:50109208-50109230 CTGCAGGGACTGATGCAGGGAGG - Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1150800505 17:68278252-68278274 CTGAAGTGCCTGATGGAGGATGG - Exonic
1151298278 17:73201959-73201981 CTGAAGGAACTGATTGAGGTTGG - Intronic
1151427702 17:74041755-74041777 ATGCAGGGACAGAGAGAGGAAGG - Intergenic
1151475883 17:74344200-74344222 CTGACGGGACAGGTGGGGGAGGG - Intronic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1151978240 17:77494327-77494349 ATGAAGGGACAGAGAGAGGAAGG - Intronic
1152006601 17:77686084-77686106 ATGGATGGATAGATGGAGGAAGG - Intergenic
1152018893 17:77770326-77770348 GAGAAGGGACAGAGGGAGGGAGG - Intergenic
1152251609 17:79215473-79215495 CTCAAGGAACAGATGGAGAAAGG - Intronic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152520358 17:80852648-80852670 CTGGAGGGGCAGATGGGGTATGG - Intronic
1154107443 18:11534562-11534584 CTGAAGCGCCAGCAGGAGGAGGG - Intergenic
1154154738 18:11934992-11935014 ATGGAGGGAGAGAGGGAGGAAGG + Intergenic
1154197657 18:12278401-12278423 CTGCAGGCACAGCTGGACGAAGG + Intergenic
1155320509 18:24614184-24614206 CTGCAGGGCCAGCTGTAGGAGGG + Intergenic
1155394539 18:25373050-25373072 CAGAAGGGAAAGATTGAGAAAGG - Intergenic
1156305265 18:35873345-35873367 CTGATGGCACAGTTGGAGGAGGG - Intergenic
1156345218 18:36251011-36251033 CTGAAGTGACAGATGCTGCAAGG - Intronic
1157239837 18:45998636-45998658 CTGAAGGGAAAAAGGGAGGAAGG - Intronic
1157394663 18:47331640-47331662 AAGAAGGGACAGAGGGAGGGAGG - Intergenic
1157442818 18:47723387-47723409 CTGAAGGGACAAATGAGGGAGGG - Intergenic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1157583596 18:48787376-48787398 AGGAAGGGAGAGAAGGAGGAAGG + Intronic
1157612750 18:48968547-48968569 AAGAAGGGACGGAGGGAGGAAGG + Intergenic
1157977488 18:52342362-52342384 CGGGAGGGACAGACGGAGGGAGG - Intronic
1158931483 18:62328201-62328223 AGGAAGGGAGAGAGGGAGGAGGG + Intronic
1159125128 18:64214892-64214914 CTGAATTGACAGGTAGAGGAAGG + Intergenic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1159673966 18:71258276-71258298 GTGAAGGGAGAGAGTGAGGATGG - Intergenic
1160851599 19:1195456-1195478 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1160852023 19:1197270-1197292 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1160984589 19:1832452-1832474 CTGCAGGGACAGCGGGAGGCCGG + Intronic
1161073111 19:2272078-2272100 GTGCAGGGACAGATGAGGGAGGG + Intronic
1161329013 19:3677745-3677767 ATGGAGGGAGGGATGGAGGATGG + Intronic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161682726 19:5687985-5688007 CTCCAGGGACAGTTGGAGGGAGG - Exonic
1161741985 19:6026934-6026956 CTGAAGGACCTGATGGAGGTGGG + Intronic
1161920468 19:7261877-7261899 CTTAAGGGACAGGTAGAAGAAGG + Intronic
1162059429 19:8085841-8085863 CAGAAGGGACAGAGGGAAGAGGG + Intronic
1162062935 19:8107688-8107710 ATGAATGGGTAGATGGAGGATGG + Intronic
1162131769 19:8530366-8530388 CTGCGGGGACAGAGGGTGGAGGG + Intronic
1162291661 19:9785493-9785515 GTGAAGGGAGAGATGGGGGTGGG - Intronic
1162474526 19:10892005-10892027 GGGAAGGGACAGAGGGAGGAGGG - Intronic
1162577677 19:11508186-11508208 CAAATGGGACAGAGGGAGGAGGG - Intronic
1162743114 19:12784125-12784147 CTGGCTGGACAGACGGAGGAGGG + Intronic
1163010209 19:14420494-14420516 GTGGAGGGAAAGAGGGAGGAAGG - Intergenic
1163383633 19:16985655-16985677 ATGAATAGATAGATGGAGGATGG + Intronic
1163435540 19:17292973-17292995 CTCAAGGGGGAGCTGGAGGATGG + Intronic
1164500712 19:28817657-28817679 CTGAAGGTAGACATAGAGGAGGG - Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1166273369 19:41732987-41733009 ATGAAGGAGCAGATGGATGAGGG - Intronic
1166312177 19:41969194-41969216 TTGAAGGGACAGACAGAGGTGGG + Intronic
1166488194 19:43232576-43232598 CAAAAGGCACAGCTGGAGGATGG - Intronic
1166494861 19:43293056-43293078 CAAAAGGCACAGCTGGAGGATGG - Intergenic
1166841798 19:45701922-45701944 CTGCAGGGAGGGATGGAGGGTGG + Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167233916 19:48302493-48302515 TTGGAGGGACAGATGATGGATGG + Intronic
1167272183 19:48511762-48511784 TTGAAGGGACAGACGGATGAAGG + Intronic
1167600482 19:50451678-50451700 CTGTAGGGTCTGAGGGAGGAGGG + Intronic
1167627814 19:50604211-50604233 CTGAAGGGAAAGATAAAGGGCGG - Intergenic
1167628173 19:50606106-50606128 CTGAAGGGAAAGATAAAGGGCGG - Intergenic
1168217878 19:54939680-54939702 CTGAAGCTGCAGATGGAGAAGGG - Exonic
1168224240 19:54982920-54982942 CTGAAGCTGCAGATGGAGAAGGG + Exonic
1168368359 19:55809543-55809565 CTGAAGCGGCAGATGGACAAGGG - Exonic
1168421077 19:56204155-56204177 CTGGAGGGATAGAGGGAGGGAGG - Intronic
1168424367 19:56226765-56226787 CTGGAGGGATAGAGGGAGGGAGG + Intronic
1168426305 19:56241978-56242000 CTGGAGGGATAGAGGGAGGGAGG - Intronic
925847833 2:8049718-8049740 CTGAAAGAAGAGATGGATGAAGG - Intergenic
926661609 2:15472774-15472796 CTGAAGGGACATATCCATGAAGG - Intronic
926964807 2:18398220-18398242 CTGAAGGGACAGTAGTAAGAGGG - Intergenic
927365909 2:22296106-22296128 ATGAAGGGAGAGAAGGAGCAGGG - Intergenic
927517280 2:23679862-23679884 CTGCTTGGCCAGATGGAGGAAGG + Intronic
928668834 2:33579661-33579683 GTTAAGGGATAGATGGAGCAGGG - Intergenic
928822380 2:35377098-35377120 AGGAAGGGAGAGAGGGAGGAAGG - Intergenic
928964289 2:36961903-36961925 CAGAAGGAACAGCTGGGGGAAGG - Intronic
929122459 2:38494671-38494693 CGGAAGGGAGAGATGCTGGAAGG - Intergenic
929251054 2:39756082-39756104 CTGAAGGGACAGATGGGTTCAGG + Intronic
929537399 2:42792389-42792411 GTGAGGGCGCAGATGGAGGAGGG + Intronic
930919036 2:56728805-56728827 GTGAGGGGAGAGAAGGAGGAGGG - Intergenic
931170621 2:59799877-59799899 CTGTGGAGATAGATGGAGGACGG + Intergenic
931578143 2:63742272-63742294 AGGAAGGGAGAGAGGGAGGAAGG + Intronic
932453363 2:71830464-71830486 AGGAAGGGAGAGATGGAGGGAGG - Intergenic
933077950 2:77953869-77953891 CTGAAGGGAAAGATAAAGGGCGG + Intergenic
933107504 2:78350549-78350571 CTGAAGAGATAGTTGGAGGTGGG + Intergenic
933546892 2:83725571-83725593 CTGAAGGGATAAATGCATGAGGG - Intergenic
933638639 2:84735045-84735067 CTGAAAGAGCAGATGGAGGGAGG - Intronic
934525499 2:95049320-95049342 GTCAAGGGAGAGGTGGAGGAAGG - Intronic
934720249 2:96569541-96569563 CTGAATGAACTGATGGGGGATGG + Intergenic
934858300 2:97742550-97742572 CTGAAGGGACAAAAGGTGAATGG - Intergenic
935124041 2:100207402-100207424 CATGAGGGACAGAAGGAGGAAGG - Intergenic
935131522 2:100264656-100264678 AGGAAGGGAAAGATGGAGGCAGG - Intergenic
935277025 2:101483936-101483958 CATAAGGGACAGAAGGTGGAAGG - Intergenic
935865825 2:107386679-107386701 CTGAAGGAACAGCTGGATGCTGG - Intergenic
936244610 2:110815958-110815980 GTGAATGGACAGATGGATGATGG + Intronic
936370874 2:111901192-111901214 CTGAAGGGCCAGGGAGAGGATGG + Intronic
937535142 2:122877046-122877068 CTGAAGGAACAGATAGATGTGGG + Intergenic
937907299 2:127058550-127058572 TTAAAGGGACAGAGAGAGGAAGG - Intronic
938138456 2:128777590-128777612 CAGAAGGGACGGAGGGAGGGAGG - Intergenic
938415282 2:131099070-131099092 CTGAAGGGAGAGAGCCAGGAAGG - Intergenic
938902055 2:135806882-135806904 TTGCAGGGCCAGATGGAGCAGGG - Intronic
939041710 2:137197270-137197292 CAGCAGAGAGAGATGGAGGAAGG + Intronic
939192104 2:138929193-138929215 ATGAAGGAAGAGAGGGAGGAAGG - Intergenic
939429847 2:142089153-142089175 TTGAAGGGACATATGGAGCCAGG + Intronic
939472387 2:142640138-142640160 AGGAAGGGAGAGAAGGAGGAAGG - Intergenic
939692543 2:145283009-145283031 CTGAATGGGCAGTTGGAGGATGG + Intergenic
939733834 2:145819264-145819286 GAGAAGGGAGAGAGGGAGGAAGG - Intergenic
939939979 2:148337586-148337608 ATGAAGAGACAGATGGCTGAGGG + Intronic
940338892 2:152558610-152558632 CTGAAAGGACATAGGGAGGAAGG - Intronic
940752286 2:157639476-157639498 CTTAAGGGACAGCTGCAGCAGGG - Intergenic
941282302 2:163567971-163567993 AGGAAGGGACGGAGGGAGGATGG + Intergenic
941350305 2:164424348-164424370 AAGAAGGAACAGAGGGAGGAAGG + Intergenic
941479232 2:165985296-165985318 AGGAAGGGAGAGAGGGAGGAAGG + Intergenic
941670105 2:168283961-168283983 CTGGAGGGACGGAAGGAGGAGGG + Intergenic
942615031 2:177782838-177782860 AGGAAGGGAAGGATGGAGGAAGG - Intronic
942629425 2:177939478-177939500 AAGAAGGGAGAGAGGGAGGAGGG + Intronic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
942961039 2:181829937-181829959 CTGTTGGGAGAGAAGGAGGAGGG - Intergenic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
943413363 2:187566776-187566798 CTAAAAGGCCAGATAGAGGAAGG + Intergenic
943808209 2:192150728-192150750 CTCAGGGAACAAATGGAGGATGG + Intronic
945270055 2:207929053-207929075 CTGAATGGATAGATGGAAGGAGG - Intronic
945484208 2:210375681-210375703 GTGAAGGAAGAGCTGGAGGAAGG + Intergenic
946552849 2:220822564-220822586 CTGGAGGGACAGATGAGGAAGGG - Intergenic
946716784 2:222561281-222561303 CTGCAGGGGCAGATGAAGGCTGG - Intergenic
947367143 2:229408419-229408441 GGGAAGGGAGAGAGGGAGGAGGG - Intronic
947541830 2:230985184-230985206 ATGAAGGGAGGGAGGGAGGAGGG + Intergenic
947591595 2:231388964-231388986 GTGGTGGGACAGGTGGAGGAGGG + Intergenic
947625640 2:231616511-231616533 TTGAGGGGACTGATGGAGGAGGG - Intergenic
947812841 2:233015151-233015173 GTGAAGGGATGGATGGTGGATGG - Intronic
947903941 2:233745923-233745945 CAGAAGGGACAGCTGGGGGTTGG + Intronic
947905344 2:233757278-233757300 CAGAAGGGACAGCTGGGGGTTGG + Intronic
948120710 2:235528323-235528345 CTGAGTGCACAGATGGTGGATGG - Intronic
948216143 2:236234312-236234334 CTGAAGGGGCTGAAGCAGGAAGG - Intronic
948456425 2:238106589-238106611 CTGGAGGGGCAAAGGGAGGATGG - Intronic
948469105 2:238166014-238166036 CTGAAGGGACTGGTGCAGGGAGG + Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169017953 20:2307009-2307031 CAGAAAGGACAGAGGGAGCAGGG - Intronic
1169244774 20:4016584-4016606 CAGGAGGGGCAGATGGAGGAGGG - Intergenic
1170501800 20:16982390-16982412 ATGAAGGAAGAGAGGGAGGAAGG - Intergenic
1170926352 20:20727944-20727966 CTGGAAGGACAGAGGGAAGAGGG + Intergenic
1171896140 20:30812351-30812373 CGGAAGGGAGAGAAAGAGGAAGG + Intergenic
1172007442 20:31827043-31827065 ATGAAGGGAAGGATGGATGAAGG - Intronic
1172421010 20:34817704-34817726 CTGAAGGGAGGGAAGGGGGAAGG + Intronic
1172461986 20:35126120-35126142 TTGGAGGGACAGGTTGAGGATGG - Intronic
1172708565 20:36901985-36902007 ATACAGTGACAGATGGAGGAAGG + Intronic
1173189396 20:40864641-40864663 CTGAAGGAAGGGATGGAGGGAGG + Intergenic
1173662663 20:44745376-44745398 ATGAAGGGACGAAGGGAGGAAGG + Intergenic
1173889669 20:46496503-46496525 CTGAAGGGAAAGCAGGAGGGTGG + Intergenic
1174746952 20:53072954-53072976 ATGGAGGGATAGATGGATGAAGG - Intronic
1174747007 20:53073165-53073187 ATGGAGGGATAGATGGATGAAGG - Intronic
1174758399 20:53182291-53182313 TTGAAGGGAGAGAGGGAGGGAGG - Intronic
1175203684 20:57294866-57294888 CTGAGGGGGCTGATGGAGCACGG - Intergenic
1175382676 20:58574641-58574663 ATGGAGAGATAGATGGAGGAAGG - Intergenic
1175390974 20:58627206-58627228 CTGTAGTGCAAGATGGAGGAGGG + Intergenic
1175408812 20:58752683-58752705 CTGAGGAGACGGATGCAGGAGGG - Intergenic
1175474885 20:59265186-59265208 CTGAAGGGACAGATTGCTGAAGG + Intergenic
1175602490 20:60286399-60286421 ATGAAGGGCCAGCTAGAGGAAGG - Intergenic
1175779247 20:61671877-61671899 GTGGATGGACAGATGGAGGATGG + Intronic
1175851811 20:62097760-62097782 CTGAAGGGGCAGGTGCAGGTGGG + Intergenic
1175983974 20:62755157-62755179 GTGGAGGGATAGAAGGAGGAAGG - Intronic
1175984180 20:62755787-62755809 CTGAAGGGAGGGATGGAGGGAGG - Intronic
1176087251 20:63303800-63303822 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
1178408725 21:32346993-32347015 CTGGAGGTACACATGGATGAGGG + Exonic
1179006741 21:37521939-37521961 CTGAAAGAATGGATGGAGGAGGG + Intergenic
1179026443 21:37682842-37682864 CTGCAGGGACAGATGGCCCAGGG - Intronic
1179081882 21:38178977-38178999 CTGAAAGGAAAGATGGAGGATGG - Intronic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1179167698 21:38947592-38947614 CAGAAAGGAGAGATGGAGGGAGG - Intergenic
1179326632 21:40352840-40352862 CTGAAGGCAGATTTGGAGGAAGG - Intronic
1179551280 21:42145568-42145590 GTGAAGGCTCTGATGGAGGAGGG + Intergenic
1180767309 22:18352575-18352597 CAGAGGGGAGAGATGGAGGCAGG - Intergenic
1180779000 22:18509804-18509826 CAGAGGGGAGAGATGGAGGCAGG + Intergenic
1180811721 22:18767124-18767146 CAGAGGGGAGAGATGGAGGCAGG + Intergenic
1180874951 22:19170935-19170957 CTGAAGGAAGAAAGGGAGGAAGG - Intergenic
1181197874 22:21201366-21201388 CAGAGGGGAGAGATGGAGGCAGG + Intergenic
1181654491 22:24284987-24285009 TTGAAGAGGAAGATGGAGGAAGG + Intronic
1181703825 22:24635534-24635556 CAGAGGGGAGAGATGGAGGCAGG - Intergenic
1181781650 22:25198081-25198103 CAGCTGGGACAGAAGGAGGAAGG - Intergenic
1181948774 22:26539397-26539419 AGCAAGGGACAGAGGGAGGAAGG + Intronic
1182100769 22:27655915-27655937 CTAGAGGGACAGATGGATGAGGG + Intergenic
1182103600 22:27673843-27673865 CTGAAGGGACAGAGGGACCTGGG - Intergenic
1182294237 22:29303736-29303758 CTCATGGGAGAGAAGGAGGAAGG + Intergenic
1182354198 22:29714945-29714967 CTGCTGGGAGAGAAGGAGGAGGG + Intergenic
1183063219 22:35347858-35347880 CAGAAGGAACAGAGGAAGGATGG - Exonic
1183085366 22:35483645-35483667 GGGGAGGGACAGAGGGAGGAAGG + Intergenic
1183209726 22:36443396-36443418 GTGAAGGGAGGGAGGGAGGAAGG - Intergenic
1183262291 22:36803516-36803538 ATGGATGGACAGATGGAGGGAGG + Intronic
1183264878 22:36818984-36819006 CAGCAGGGAGAGATGGAGGAAGG - Intronic
1183467298 22:37986193-37986215 CTGGATGGACAGAGGGACGAGGG + Intronic
1184293036 22:43508463-43508485 ATGGATGGACAGATGGGGGATGG - Intergenic
1184293283 22:43509277-43509299 ATGGACGGATAGATGGAGGATGG - Intergenic
1184460850 22:44637030-44637052 GTGAATGGATAGATGGATGATGG + Intergenic
1184460873 22:44637129-44637151 GTGAATGGATAGATGGATGATGG + Intergenic
1184882119 22:47314356-47314378 CACAAAGGACAGAAGGAGGAAGG - Intergenic
1185107567 22:48882965-48882987 CAGAAGGGATGGATGGATGAGGG - Intergenic
1185135796 22:49071415-49071437 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
1203228931 22_KI270731v1_random:93469-93491 CAGAGGGGAGAGATGGAGGCAGG - Intergenic
949519702 3:4838888-4838910 CTGAAAGGACAGATAGTGTAGGG - Intronic
949916113 3:8965878-8965900 AGGAAGGGAGAGATGGAGGCAGG - Intergenic
949956102 3:9269878-9269900 AGGGAGGGACAGAGGGAGGAAGG + Intronic
950454794 3:13086246-13086268 CAGAATGGACAGACTGAGGAGGG + Intergenic
950526645 3:13528350-13528372 CTGAAGGCACAGCTGAAGTAGGG + Intergenic
950526914 3:13529573-13529595 ATAAAGGGAGGGATGGAGGAAGG - Intergenic
950646550 3:14380796-14380818 AAGAAGGGAGGGATGGAGGAAGG + Intergenic
952344860 3:32473898-32473920 GTAAAGGGAGGGATGGAGGATGG - Intronic
952590255 3:34944314-34944336 CAGATGGGACAGAGAGAGGAAGG - Intergenic
952944785 3:38472132-38472154 CTGAAGAGACAGATGGGGCCAGG - Intronic
953521179 3:43644783-43644805 CTGAAGGGCAAGTGGGAGGAAGG - Intronic
954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG + Exonic
954144853 3:48629451-48629473 ATGAAGGGACAGAGGGAGAGTGG - Intronic
954454896 3:50592536-50592558 ATGAGGGGACAGATGCTGGAGGG - Intergenic
954710341 3:52502300-52502322 CTGAAGGGACAGGTGGGAGCTGG - Intronic
955634663 3:61014369-61014391 GTGAAAGGAGAGATGGAGGGAGG + Intronic
955689809 3:61579828-61579850 CTGTAGGGATACATGGAGTAGGG + Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956710624 3:72035613-72035635 CTGATTGCACAGATGAAGGAAGG - Intergenic
956718385 3:72098156-72098178 CTGAAGGGACAAGGGGAGCAGGG + Intergenic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
956748074 3:72325153-72325175 GTGAAGGGACAGGGGGAGGGAGG + Intergenic
956781746 3:72608737-72608759 CTGAAGAGACTGATGGAGAGGGG + Intergenic
958782018 3:98554043-98554065 CTGAAGGGACTAAAAGAGGAAGG - Intronic
959392499 3:105793404-105793426 CATAAGGAACTGATGGAGGAAGG + Intronic
960406196 3:117262773-117262795 CTGAAGGGAAAGATTCATGATGG + Intergenic
961159421 3:124710322-124710344 TGGCAGGGACAGAGGGAGGAAGG + Intronic
961173280 3:124814285-124814307 CTGAAGGGAGGGGTGGAAGAAGG + Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961751103 3:129095380-129095402 CCCCAGGGAAAGATGGAGGAAGG + Intronic
961957677 3:130821005-130821027 CAAAAGGGGCAGATGGAGAAAGG + Intergenic
962153526 3:132918621-132918643 CCATAGGGACAGATGCAGGAAGG + Intergenic
962414493 3:135169631-135169653 CTGAAGGCTCTGATGGAGGGAGG + Intronic
962753864 3:138453558-138453580 TGGAAGGGGCACATGGAGGAAGG + Intronic
963309026 3:143687993-143688015 AGGAAGGGAGAGAGGGAGGAGGG - Intronic
963913015 3:150830986-150831008 CGGATGGGACGGAGGGAGGAAGG - Intergenic
964184420 3:153925231-153925253 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
964934300 3:162062156-162062178 AAGAAGGGACAGAGGGAGGGAGG - Intergenic
965211649 3:165797324-165797346 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
965600911 3:170453989-170454011 CTGAGGGGAGAGATGGCGGTGGG - Intronic
967446955 3:189578043-189578065 CTGAAGGGAAAGTAGGAGGAAGG - Intergenic
967467134 3:189820570-189820592 CAGAAGGGACAAAAGGAGAAAGG + Intronic
967503392 3:190225431-190225453 ATGAAGGGAGGGAGGGAGGAAGG - Intergenic
967557575 3:190876877-190876899 CTGAAGGGAAAGATAAAGGGTGG + Intronic
967568494 3:190999701-190999723 GTGAAGGGAGGGAGGGAGGAAGG + Intergenic
967830155 3:193911771-193911793 CTGAAGAGACAAAAGAAGGAGGG - Intergenic
967864246 3:194177331-194177353 TGGAAGGCACAGATGGAGGAAGG + Intergenic
967894700 3:194386420-194386442 CGTAAGGGACAGAAGGAGGCAGG - Intergenic
968131198 3:196193941-196193963 GGGCAGGGACAGATGGGGGAAGG - Intergenic
968164587 3:196454334-196454356 CTGAAGGAAGAAATGGAGAACGG + Intergenic
968487886 4:872684-872706 CTCAAGGGGCAGCTGGGGGAGGG - Intronic
968495001 4:910552-910574 CTGAAGGGACAGGTAGGGGTGGG - Intronic
968720249 4:2197231-2197253 CTGAAGGGGCAGGTGGAAGCAGG + Intronic
968730092 4:2265416-2265438 CTCTTGGGACATATGGAGGACGG + Intergenic
969137064 4:5037930-5037952 CTGAAGGGACGGAAGGGGGAGGG + Intergenic
969270289 4:6095024-6095046 GGGAAGGGACAGAGGGAGGGAGG + Intronic
969424823 4:7118068-7118090 GTGGATGGATAGATGGAGGAAGG + Intergenic
969522944 4:7689341-7689363 TTGGAGGAACGGATGGAGGATGG - Intronic
969523049 4:7689924-7689946 GTGAATGGATGGATGGAGGATGG + Intronic
969523851 4:7694129-7694151 CTGCAGGGGCAGAGGAAGGATGG + Intronic
969608205 4:8212678-8212700 CTGGAGGGGCAGACGGAGGTTGG - Intronic
969882642 4:10187790-10187812 CTGAGGGGACAGTTGGAAGGTGG + Intergenic
970199683 4:13590973-13590995 CTCAAGGGACTGAGGTAGGATGG + Intronic
970689949 4:18611526-18611548 AGGAAGGGATGGATGGAGGAGGG + Intergenic
972639391 4:40911886-40911908 GTGTAGGGGCAGAGGGAGGAGGG - Intronic
972697189 4:41459286-41459308 AGGAAGGGACAGAGGGAGGGAGG - Intronic
972874317 4:43339591-43339613 CTCAAGGGTCAAATGCAGGAGGG - Intergenic
973759548 4:54103688-54103710 GTCAAGGGACATAGGGAGGAGGG + Intronic
974339436 4:60596016-60596038 CTGAAGGAAAAGATTGGGGAAGG - Intergenic
974881083 4:67757875-67757897 CTGAAGGGAAAGAGTGATGATGG + Intergenic
975611049 4:76203707-76203729 ATGAAGGAACAGATGCAGGCTGG + Intronic
975736733 4:77388689-77388711 CTGAGGGTAAAGATTGAGGATGG - Intronic
975905329 4:79204538-79204560 AGGAAGGGACGGAGGGAGGAAGG - Intergenic
975933365 4:79553856-79553878 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
976085992 4:81407682-81407704 CTGAAGAAAGGGATGGAGGATGG + Intergenic
976168196 4:82276768-82276790 CTTAAGGGAGGGATGGAGGGAGG + Intergenic
976639591 4:87323949-87323971 CTCAAGTGGCAGAAGGAGGAAGG + Intergenic
976761779 4:88557035-88557057 TAAAAGGGATAGATGGAGGAAGG - Intronic
976837010 4:89386116-89386138 ATGGAGGGACAGAGGGAAGAAGG + Intergenic
977136496 4:93311198-93311220 CTGAAGAGACAGCTGGAGTCAGG + Intronic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
977336850 4:95710347-95710369 AGAAAGGGACAGAGGGAGGAAGG - Intergenic
977362688 4:96026199-96026221 GTGAAGGTACAGGTGTAGGATGG - Intergenic
977609874 4:99020613-99020635 CTGAAGCAAGGGATGGAGGAGGG - Intronic
978165011 4:105596482-105596504 CTGAAAGGAGACAGGGAGGAGGG + Intronic
979207607 4:118059062-118059084 AGGAAGGGAGAGATGCAGGAGGG - Intronic
980423896 4:132600035-132600057 CTGCTGGGACAGATGGAGGTTGG - Intergenic
983552558 4:169032417-169032439 AAGAAGGGAGAGAAGGAGGAAGG - Intergenic
984040649 4:174728854-174728876 GTGTTGGGACAGAGGGAGGATGG + Intronic
984177264 4:176434805-176434827 AGGAAGGGACAGAGGGAGGGAGG - Intergenic
984428310 4:179615941-179615963 TTGAAGGGAGAACTGGAGGATGG + Intergenic
985099513 4:186444489-186444511 CTGAGTGGACAGCTGTAGGAGGG + Intronic
985314430 4:188640493-188640515 AGGAAGGGACAGATGGAGAAAGG - Intergenic
985422827 4:189801654-189801676 CAGAAGGGACACAGGGATGATGG - Intergenic
986032423 5:3906599-3906621 ATAAAGAGACAGATTGAGGAGGG + Intergenic
986131686 5:4937873-4937895 CTGAAGGAGCAGGTGGAGCATGG - Intergenic
986163326 5:5250890-5250912 CTAAAGGGACGAATGGAGGGAGG - Intronic
986313378 5:6571142-6571164 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986313391 5:6571177-6571199 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986313415 5:6571247-6571269 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986313470 5:6571414-6571436 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986313483 5:6571449-6571471 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986313496 5:6571484-6571506 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986313520 5:6571554-6571576 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986313548 5:6571633-6571655 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986313561 5:6571668-6571690 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986313574 5:6571703-6571725 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986418611 5:7553660-7553682 CTGAGGGGACAGAAGCAGGGAGG + Intronic
986770461 5:10968215-10968237 GTGAAGGAGAAGATGGAGGAAGG - Intergenic
988087313 5:26488289-26488311 ATGAAGGAAGAGAAGGAGGAAGG - Intergenic
988882534 5:35518802-35518824 CTGAAGTTCCAGATGGAGGGAGG - Intergenic
988968031 5:36439547-36439569 ATGAAGGGACAAATTCAGGAAGG + Intergenic
989202065 5:38773549-38773571 CAGAAGGAACAGATGGAGGAAGG + Intergenic
989814935 5:45724462-45724484 ATGGAGGGAGAGAGGGAGGAGGG - Intergenic
990010628 5:50993530-50993552 CTGCAGGGACAAAGGTAGGAGGG + Intergenic
990356851 5:54976133-54976155 CTGAAGGGATGGTTGGTGGAAGG - Intergenic
990378233 5:55194731-55194753 CTGAAAGGACAGAAAGAGGCTGG - Intergenic
991006831 5:61836167-61836189 CTCAAGAGAGAGATGGTGGAAGG + Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992573981 5:78092135-78092157 TTGAAAGGACAGATGGTGGACGG - Intronic
992846606 5:80755647-80755669 CTGAGGGAACAGATGGAAAAAGG + Intronic
993001912 5:82389028-82389050 CTGAAGGAGCACATGGAGGGCGG - Intergenic
994789723 5:104207717-104207739 CTCAAGGGGCATCTGGAGGAGGG + Intergenic
996391556 5:122967912-122967934 CTGAAGGGTCAGATTAAGGGAGG - Intronic
996701627 5:126456183-126456205 CTGAGGGGGCAGATAGGGGATGG - Intronic
997487940 5:134247697-134247719 ATGAAGGAACAGAGGGAGAAAGG + Intergenic
997507568 5:134430177-134430199 CCTAAGGGACAGATGGAGAAAGG + Intergenic
997552398 5:134764830-134764852 AGGAAGAGAGAGATGGAGGAAGG - Intronic
997729457 5:136156595-136156617 CTGAAGGAACTGATGAAGAAAGG + Intronic
997745680 5:136298308-136298330 CTGAAGGAACAGAGGCAGGCAGG + Intronic
997745758 5:136298778-136298800 TTGAAGGGGCAGAAGCAGGATGG - Intronic
998038582 5:138936731-138936753 CACCAGGGGCAGATGGAGGATGG - Intergenic
998084630 5:139308972-139308994 CTAAAGGGACAGATGTAACATGG - Intronic
998815053 5:146005554-146005576 TTGAAGGAAGGGATGGAGGAAGG + Intronic
998989085 5:147795252-147795274 CTGAAGGTGTGGATGGAGGAGGG - Intergenic
998999686 5:147906982-147907004 CCGAAGGGAGACAAGGAGGAGGG - Intergenic
999641531 5:153677987-153678009 CCGAAGGGACAGGGAGAGGATGG + Intronic
999805481 5:155077298-155077320 CTTTAGTGACAGATGGAGCATGG - Intergenic
999872329 5:155765416-155765438 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
999904494 5:156124755-156124777 AGGGAGGGACAGATGGAGGGAGG + Intronic
1000346741 5:160320899-160320921 AGGAAGGGACAGAGGGAGGGAGG - Intronic
1000847631 5:166301184-166301206 CTGATGGGATAGATTGAGAAAGG - Intergenic
1001421442 5:171590246-171590268 ATGGATGGACAGATGAAGGATGG - Intergenic
1001678309 5:173536692-173536714 GTGAAGGGACTGATGCATGATGG + Intergenic
1001832970 5:174805080-174805102 GTGAAGACACAGATGCAGGAGGG - Intergenic
1001865677 5:175103022-175103044 ATGAATGGATAGATGGATGATGG + Intergenic
1002341632 5:178520069-178520091 ATGGATGGATAGATGGAGGATGG + Intronic
1002598469 5:180339656-180339678 ATGAAAGGACAGAGGGATGATGG - Intronic
1002625599 5:180526304-180526326 CTGAAGGTAAAGATCCAGGAGGG + Intronic
1003563909 6:7206437-7206459 CTGAATGGACAAATGAAGGAAGG - Intronic
1003689388 6:8337579-8337601 GGGAAGGGACAGAAGGAGGCTGG + Intergenic
1004588889 6:17029864-17029886 CAGAATGGAAAGGTGGAGGAAGG + Intergenic
1005018775 6:21398422-21398444 GGGAAGGGACAGAGGGAGGGAGG - Intergenic
1006335291 6:33417423-33417445 ATGAAGGGACAGTTGGGGGTGGG - Intronic
1006387484 6:33739410-33739432 GGGAAGGGGCAGAAGGAGGAGGG + Intronic
1006443731 6:34067537-34067559 AGGAAGGGACAGAGGGAGGGAGG - Intronic
1007009348 6:38400171-38400193 CTGATGGGACAGGTAGAAGAAGG - Intronic
1007174026 6:39884179-39884201 GGGAAGGGGAAGATGGAGGAAGG - Intronic
1007282105 6:40720388-40720410 CGGGAGGGACAGAGGGAGGGAGG + Intergenic
1007396709 6:41582184-41582206 CGGAAGGGACAGTGGGAGCAGGG - Intronic
1007406418 6:41638451-41638473 CTGGAGGGAGAGAAGGAAGAAGG + Exonic
1007416597 6:41694722-41694744 CTGAAGGGCCAGATGGTGGGAGG - Intronic
1007567399 6:42863002-42863024 TTGAGGGTACAGATGGAGGCAGG - Intronic
1007757140 6:44107220-44107242 CTGATGGGTCAGAGGGAGGCAGG - Intergenic
1007915132 6:45554321-45554343 CTGAAGGGAGGGAAGGAGGAGGG + Intronic
1007958870 6:45940986-45941008 ATGAAGGGCCTGATGTAGGATGG + Intronic
1008426895 6:51369226-51369248 ATGATAGGACAGATGGAGTAAGG + Intergenic
1008902701 6:56640340-56640362 CTGGAGTGACAGATGGAGTCAGG + Exonic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1010015059 6:71095405-71095427 CTGAGGGGACAGTTGGGAGAGGG - Intergenic
1010106388 6:72174117-72174139 CTCAAATCACAGATGGAGGAGGG - Intronic
1010155086 6:72783181-72783203 CTGTAGAGAGAGATGGTGGAGGG + Intronic
1010342808 6:74776238-74776260 CAGTAGGGACAGATGGAGGCAGG - Intergenic
1010704307 6:79089680-79089702 ATGGAGGGAAAGAGGGAGGAAGG - Intergenic
1011563480 6:88647742-88647764 AGGAAGGGAGAGAGGGAGGAGGG + Intronic
1012887387 6:104860919-104860941 ATGAAGGGGCAGATGGTGGTTGG + Intergenic
1012980975 6:105830806-105830828 CAGAAGGGGCAGCTGGAGGAGGG + Intergenic
1012981006 6:105830891-105830913 GGGAAGGGGCAGCTGGAGGAGGG + Intergenic
1012981014 6:105830912-105830934 GGGAAGGGGCAGCTGGAGGAGGG + Intergenic
1012981022 6:105830933-105830955 GGGAAGGGGCAGCTGGAGGAGGG + Intergenic
1012981044 6:105830995-105831017 GAGAAGGGGCAGCTGGAGGAGGG + Intergenic
1012981121 6:105831191-105831213 GGGAAGGGGCAGCTGGAGGAGGG + Intergenic
1012981135 6:105831234-105831256 GAGAAGGGACAGCTGGAGGAGGG + Intergenic
1012981143 6:105831255-105831277 GGGAAGGGGCAGCTGGAGGAGGG + Intergenic
1012999084 6:106003937-106003959 GAGGAGTGACAGATGGAGGAAGG + Intergenic
1013363937 6:109421027-109421049 CTGAAGGGATTGATGGTGGGGGG - Intronic
1014228582 6:118876220-118876242 TTGAAGGGAAAGAGGGATGAGGG + Intronic
1014241172 6:119019153-119019175 GTAAGGGAACAGATGGAGGAGGG + Intronic
1014746626 6:125208462-125208484 CAGAAGGGATTGGTGGAGGAGGG + Intronic
1015972684 6:138758579-138758601 CAGAAGGGAGAGAGGGAGCAGGG - Intronic
1016461911 6:144286469-144286491 CTGAGGGGACAGGAGGAGGGGGG + Intronic
1017039323 6:150295117-150295139 CTGAAGAGACAAAGGGAGGAAGG + Intergenic
1017767247 6:157616633-157616655 CTGAAGGGACAGAGGGATTGTGG + Intronic
1018291687 6:162298282-162298304 CAGAAGGGACATCTGGTGGATGG - Intronic
1018501219 6:164412918-164412940 ATGAAGGGACAGCTGAAGGCTGG + Intergenic
1019272207 7:156638-156660 CAGAGGGTACAGATGGAGCAGGG - Intergenic
1019805122 7:3117932-3117954 CAAAAGGGACAAATGCAGGAGGG - Intergenic
1019845310 7:3493298-3493320 CTGAATGGACAGTTAGATGAAGG - Intronic
1020106043 7:5422770-5422792 CTGATGGGAGAGAGGGAGGGAGG - Intronic
1021352287 7:19609928-19609950 AAGAAGGAACAGAGGGAGGAAGG - Intergenic
1022027897 7:26465914-26465936 CTAAAGGAACAGAAGGAGCAAGG + Intergenic
1022033314 7:26512224-26512246 CTGAAGGTACTGAAGGAAGACGG + Intergenic
1022202974 7:28136007-28136029 CTGAAGTGAAACATGGAGAATGG - Intronic
1022464884 7:30646957-30646979 CTGAATGGCCAGAGGGAGTACGG + Intergenic
1022491480 7:30823457-30823479 ATGAAGGGAAAGAAGGAAGAAGG - Intronic
1022797509 7:33743976-33743998 ATGAAGGGAAAGATTGAGGAAGG - Intergenic
1023060808 7:36323998-36324020 CTCATGGGACATATGGAGAAAGG - Intergenic
1023724873 7:43132555-43132577 CTAAAGGGAGGGGTGGAGGAAGG - Intronic
1024168259 7:46756739-46756761 GAGAAGGGAGAGAAGGAGGAAGG + Intronic
1024718730 7:52110232-52110254 CTGAAGGGAAAGATGAAGGCAGG + Intergenic
1025117155 7:56268258-56268280 AGGAAGGGACAGAGGGAGGGAGG - Intergenic
1025735541 7:64143606-64143628 ATGCAGGGACGGATGGAGGGAGG + Intronic
1026196396 7:68177280-68177302 ATGAAGGGACAGATGACTGAAGG + Intergenic
1026336652 7:69399454-69399476 CAGAAGGGATAGATGGGGAAAGG - Intergenic
1026589032 7:71680307-71680329 AGGAAGGGATAGAGGGAGGAAGG - Intronic
1026671249 7:72392461-72392483 CTGATGGGAGAGACTGAGGAAGG + Intronic
1026833011 7:73621760-73621782 AGGAAGGGAGAGAGGGAGGAAGG - Intronic
1029628868 7:101737809-101737831 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
1029673098 7:102047481-102047503 ATGAAGGGAGAGATGGAGGGAGG + Intronic
1030365499 7:108641358-108641380 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
1030651249 7:112118624-112118646 CTGAAGGGAAAAACGTAGGAAGG - Intronic
1030891143 7:115001045-115001067 CTGAAGGGAAAAATGGAAGATGG + Intronic
1031564194 7:123274650-123274672 CTGAATGGGCACAAGGAGGAAGG - Intergenic
1031769097 7:125820486-125820508 CGGAAGGGAGAGAGGGAGGGAGG + Intergenic
1031780785 7:125961461-125961483 CTGATGGAACAGCAGGAGGAGGG - Intergenic
1031922636 7:127612985-127613007 CTGAGCGGGCAGATGGATGATGG + Intronic
1032233746 7:130101539-130101561 GTGAAGGGAGAGAAGGAGTAGGG - Intronic
1032506212 7:132436486-132436508 GTGAAGGTGCAGGTGGAGGAAGG - Intronic
1032625124 7:133583689-133583711 CTGAAGGGAGAGATGGGGAAAGG + Intronic
1032704904 7:134413317-134413339 TTGAACGGAAAGGTGGAGGAGGG - Intergenic
1033643815 7:143286245-143286267 CTACAGGGAGAGAGGGAGGATGG - Intronic
1034194054 7:149232496-149232518 CGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1035050016 7:155993356-155993378 CAGAAGGGGCTGATGGAGGCAGG - Intergenic
1035050049 7:155993536-155993558 CAGAAGGGGCTGATGGAGGCAGG - Intergenic
1035063846 7:156091248-156091270 CTGAAGGGGCCCCTGGAGGAGGG - Intergenic
1035070166 7:156138615-156138637 CTGAATGTGCTGATGGAGGAGGG + Intergenic
1035352047 7:158253908-158253930 CTGAACGTAGAGATGGAGGGCGG - Intronic
1035464322 7:159064809-159064831 CTGCAGGGACTGAAGGAGGGAGG - Intronic
1036512948 8:9417543-9417565 CTGAAGGGCCAGCAGGAGGCTGG - Intergenic
1037339817 8:17832286-17832308 CAGAAGGAACGGAAGGAGGAAGG + Intergenic
1037644230 8:20775762-20775784 CTGAAGGAACAGGTGGTGGCTGG + Intergenic
1038017970 8:23530538-23530560 CTGGAGGGACATATGGGTGATGG - Intronic
1038271871 8:26081924-26081946 CTGAAGGCACCTGTGGAGGAAGG - Intergenic
1039265836 8:35823011-35823033 CTGAGTGGACAGACTGAGGAGGG - Intergenic
1039781646 8:40792526-40792548 AGGAAGGGACAGAGGGAGGGAGG + Intronic
1039954306 8:42195419-42195441 CTGATGGGACAGGTGCAGGGAGG - Intronic
1040523753 8:48199941-48199963 AAGAAGGGAGAGAGGGAGGAGGG - Intergenic
1041447695 8:57970775-57970797 AGGAAGGGACAGAGGGAAGAAGG - Intergenic
1041627947 8:60052727-60052749 GTGATAGGACACATGGAGGAAGG - Intergenic
1042036667 8:64540946-64540968 AGGAAGGGAGAGAGGGAGGAAGG + Intergenic
1042810605 8:72821812-72821834 GTGAAGGGAAGGATGGAGGGAGG + Intronic
1044230823 8:89775805-89775827 CTCAAAGGAAACATGGAGGATGG + Intronic
1044258727 8:90094326-90094348 CTGAGGGGACAGGCGGAGGGGGG + Intronic
1044625769 8:94234281-94234303 CTGAAGCGCCAGAGGGCGGATGG - Intergenic
1044885511 8:96772592-96772614 TTTAAAGGACAGATGGGGGAAGG + Intronic
1044929914 8:97242059-97242081 GTGAAGGGGCACAGGGAGGAAGG - Intergenic
1045149770 8:99391392-99391414 CTGTGGGGACAGATGAGGGAGGG + Intronic
1046958266 8:120083666-120083688 CTGAAGGGACTGTGGGAAGAAGG - Intronic
1047006891 8:120630121-120630143 CTGAAGGGGCAAAGGGAGGCTGG - Intronic
1047078600 8:121434056-121434078 CTGAGGTAACAGATGGAGTAGGG + Intergenic
1048007693 8:130432178-130432200 GAGAAGGGAGAGAGGGAGGAAGG + Intronic
1048049321 8:130802584-130802606 CTGAAGAGATAGGTGGAGGCAGG - Intronic
1048365667 8:133736285-133736307 AGGAAGGGAGAGATGGAGGGAGG - Intergenic
1048369880 8:133768028-133768050 CAGGAGGAAGAGATGGAGGAAGG - Intergenic
1048988731 8:139749133-139749155 AGGGAGGGACAGATGGAGCAGGG - Intronic
1049181680 8:141226189-141226211 CAGAGGGGAAAGATGGAGAAAGG - Intronic
1049398538 8:142413098-142413120 CTCAATGGAGAGATGGAGGCTGG - Intergenic
1049641954 8:143719844-143719866 CTGAGGGAAGAGGTGGAGGAAGG + Intronic
1050534526 9:6620108-6620130 GCAAGGGGACAGATGGAGGATGG + Intronic
1051044453 9:12856573-12856595 GTGAGGGGGCAGATGGATGAAGG + Intergenic
1052367652 9:27631199-27631221 CTGAAGGGGATGATGAAGGAGGG + Intergenic
1052415593 9:28172638-28172660 CTTCAGGGAAAGATGGAGAAAGG + Intronic
1053417054 9:37953475-37953497 CTGATGGTAATGATGGAGGAAGG + Intronic
1054769859 9:69073568-69073590 ATGAAGGGGCAGATAAAGGAAGG + Exonic
1056684527 9:88748639-88748661 CTGAAGGCAAAGAGGGAGGCTGG + Intergenic
1056932912 9:90893489-90893511 ATGAAGGGAGAGAAGGAGGGAGG + Intronic
1057001490 9:91513907-91513929 GGGAAGGGACAGATTGAGGTGGG + Intergenic
1057008701 9:91583223-91583245 CTGGATGGATGGATGGAGGATGG + Intronic
1057745133 9:97745363-97745385 CTAAAGGACCAGATGGAGCATGG - Intergenic
1057761265 9:97876497-97876519 CTTAAGAGGGAGATGGAGGAAGG + Intergenic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1059140413 9:111847652-111847674 CTAAAGGGGCAGTTGGAGGACGG + Intergenic
1059252200 9:112895688-112895710 ATGAATAGACAGATGGATGATGG - Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059762759 9:117354688-117354710 CTGGAGGGAGGGAAGGAGGAGGG - Intronic
1060217489 9:121747010-121747032 CTGAGTGGAGAGATGGGGGAGGG + Intronic
1060260588 9:122070646-122070668 CTGAGGGGACAGAGGAATGAAGG + Intronic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1061746343 9:132743002-132743024 CTGAAGGAACAAGGGGAGGAGGG + Intronic
1061963340 9:133999038-133999060 GTGGAGGGATAGATGGAGGGAGG - Intergenic
1062092308 9:134684890-134684912 GTGAATGGATAGATGGTGGATGG - Intronic
1062103550 9:134740584-134740606 CTGGATGGATAGAAGGAGGACGG - Intronic
1062172238 9:135141335-135141357 ATGAATGGACAGATGATGGATGG + Intergenic
1062172270 9:135141566-135141588 ATGAGTGGACAGATGGATGATGG + Intergenic
1062201342 9:135304435-135304457 ATGAATGGATAGATGGATGATGG + Intergenic
1062535581 9:137019835-137019857 CTTAAGGGACACATGGAGACAGG - Intronic
1062701203 9:137904676-137904698 TTGAGGGGACAGCAGGAGGAGGG - Intronic
1185700791 X:2228382-2228404 ATGAAGGGAGGGAGGGAGGAAGG + Intronic
1185820220 X:3195907-3195929 CAGAAAGGAGGGATGGAGGAAGG + Intergenic
1185872473 X:3675448-3675470 GAGAAGGAAGAGATGGAGGAGGG - Intronic
1185959140 X:4528193-4528215 TAGCAGGGAGAGATGGAGGAAGG - Intergenic
1186145642 X:6621643-6621665 AGGAAGGGAAAGAAGGAGGAAGG + Intergenic
1186214432 X:7283747-7283769 CTGAAGTGGCAGATGGTGGTGGG + Intronic
1187071099 X:15889223-15889245 CTGTAAGAACAAATGGAGGAGGG + Intergenic
1187813161 X:23202815-23202837 CAGGAGGGACAGATAGAGGCAGG + Intergenic
1187926136 X:24252017-24252039 CTAAAGGGACAGCAGAAGGAGGG - Intergenic
1188293491 X:28417393-28417415 CTGAATGGACTGATGCAGCATGG - Intergenic
1189302109 X:39959662-39959684 CAGCAGGGAAAGATGGAGGAGGG + Intergenic
1189429345 X:40933152-40933174 CTGAAGGGAAAGGGGGAGAAGGG - Intergenic
1189960344 X:46318585-46318607 CAGAAGGAAGGGATGGAGGAAGG + Intergenic
1190074047 X:47302678-47302700 CGGAGGGGAAAGAGGGAGGAGGG - Intergenic
1190220293 X:48508694-48508716 GAGAAGGGAAAGATGGGGGAGGG - Intergenic
1192230711 X:69263121-69263143 CTGAAGGGTAAGATGGGGGGAGG - Intergenic
1192424999 X:71067800-71067822 CTGAAGGAAGGGAGGGAGGATGG - Intronic
1195574200 X:106431534-106431556 CTGAAGGGGCTGGAGGAGGAAGG - Intergenic
1195870566 X:109481029-109481051 ATGAAGGGAGAGAAGAAGGAAGG + Intronic
1196181605 X:112698169-112698191 CTGAAGGGCCAGAAGGAAGGCGG - Intergenic
1197014737 X:121609768-121609790 ATGAAGGGAGAGAGGGAGGGAGG + Intergenic
1197043310 X:121966655-121966677 CTGAAGAGACAGAGGTAGAAAGG + Intergenic
1197727798 X:129787964-129787986 CTGAAGGGAGAGCTGGAAAAAGG - Exonic
1197951714 X:131904711-131904733 TTGACGAGGCAGATGGAGGATGG - Intergenic
1197970496 X:132110241-132110263 TTTAAGGGATAGGTGGAGGAGGG + Intronic
1199478312 X:148270564-148270586 CTGAAGGGAGAGTTGGATGTTGG + Intergenic
1200242197 X:154502810-154502832 CTGAAGGAACAAATGGAGGAAGG + Intergenic
1200246578 X:154529748-154529770 CTGAAGGGACAGTTGCCTGATGG + Intergenic
1200411966 Y:2869737-2869759 CCTAAGAGACAGATGGAAGAAGG + Intronic
1200569002 Y:4804342-4804364 CTGAGGGGACAGAGGCAAGAAGG - Intergenic
1201334887 Y:12869957-12869979 CAGGAGGGAGAGAAGGAGGAAGG - Intergenic
1201562194 Y:15329960-15329982 ATGAAGGGAGAGCAGGAGGAAGG - Intergenic
1201756405 Y:17491204-17491226 TTCATGGGACAGATGAAGGAAGG + Intergenic
1201845147 Y:18414781-18414803 TTCATGGGACAGATGAAGGAAGG - Intergenic
1202231784 Y:22666266-22666288 AGGAAGGGAGAGAGGGAGGAAGG - Intergenic
1202311374 Y:23529899-23529921 AGGAAGGGAGAGAGGGAGGAAGG + Intergenic
1202559428 Y:26140695-26140717 AGGAAGGGAGAGAGGGAGGAAGG - Intergenic