ID: 1161465858

View in Genome Browser
Species Human (GRCh38)
Location 19:4429976-4429998
Sequence TCTGGTGACACTCGCCCACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 52}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161465855_1161465858 8 Left 1161465855 19:4429945-4429967 CCAGACTTCCAGCTTCTCTCGAA 0: 1
1: 1
2: 15
3: 54
4: 230
Right 1161465858 19:4429976-4429998 TCTGGTGACACTCGCCCACGTGG 0: 1
1: 0
2: 0
3: 3
4: 52
1161465853_1161465858 27 Left 1161465853 19:4429926-4429948 CCTGAACGCACCTCAACATCCAG 0: 1
1: 0
2: 1
3: 5
4: 68
Right 1161465858 19:4429976-4429998 TCTGGTGACACTCGCCCACGTGG 0: 1
1: 0
2: 0
3: 3
4: 52
1161465854_1161465858 17 Left 1161465854 19:4429936-4429958 CCTCAACATCCAGACTTCCAGCT 0: 1
1: 0
2: 3
3: 30
4: 263
Right 1161465858 19:4429976-4429998 TCTGGTGACACTCGCCCACGTGG 0: 1
1: 0
2: 0
3: 3
4: 52
1161465856_1161465858 0 Left 1161465856 19:4429953-4429975 CCAGCTTCTCTCGAAAAATCTCA 0: 1
1: 0
2: 4
3: 29
4: 202
Right 1161465858 19:4429976-4429998 TCTGGTGACACTCGCCCACGTGG 0: 1
1: 0
2: 0
3: 3
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161465858 Original CRISPR TCTGGTGACACTCGCCCACG TGG Intronic
901131028 1:6962663-6962685 TCTGGTTCCACCCACCCACGTGG + Intronic
905167714 1:36092698-36092720 TCTGGGGACACTGGTCCACAAGG - Intronic
905871081 1:41404957-41404979 TATGGTGACACTCAGCCACAGGG - Intergenic
911858354 1:102912175-102912197 TCTGGTGAGGCTGGCCCACCAGG - Exonic
913537768 1:119790644-119790666 TCTGTTGACCTTTGCCCACGGGG - Intergenic
1078433137 11:11302925-11302947 TGTGGTGACAATCCCCCTCGGGG + Intronic
1083194002 11:61072201-61072223 TCTGGTGAGACTGCCCCAGGCGG - Intergenic
1093156214 12:15688885-15688907 CCCTGTAACACTCGCCCACGGGG + Intronic
1095891131 12:47235843-47235865 TCTTGATCCACTCGCCCACGGGG - Exonic
1101241784 12:102846423-102846445 TCTGATGACACTTGTCCACTGGG - Intronic
1103724039 12:122989167-122989189 TCTGGTGACCCTCTGCCCCGTGG + Intronic
1113872192 13:113566112-113566134 TCTGCTGACAAGCGCACACGAGG - Intergenic
1122265406 14:100544477-100544499 TCTGGTGCCACTCCCTCACTAGG - Intronic
1122614891 14:103010439-103010461 TCTGGTGAGACTCACTCATGGGG + Intronic
1140242636 16:73217413-73217435 TCAGGTCACACTGGCCCACAGGG + Intergenic
1146039044 17:29433785-29433807 TCTGGGGACCCTCTCCCACCTGG + Intronic
1147458497 17:40553612-40553634 TCTGGTGACACAGGACCAAGAGG - Intergenic
1151565203 17:74893700-74893722 CCTGGGGACACCCGCCCCCGGGG + Intronic
1152662988 17:81551633-81551655 TCTGGTGAGACACGCCCCCGAGG - Intronic
1161020982 19:2011404-2011426 TCTGGTCACACTGGGCCACAGGG + Intronic
1161465858 19:4429976-4429998 TCTGGTGACACTCGCCCACGTGG + Intronic
1162119965 19:8458538-8458560 TCTGGTGGCACTGCCCCACCTGG - Intronic
1168564073 19:57408541-57408563 TATGGTGACAATGGCCCAGGAGG - Intronic
925260540 2:2524801-2524823 TCTGGTGACACACGGCCGTGAGG - Intergenic
927408520 2:22799336-22799358 ACTGGAGACACTCCCCCAAGAGG + Intergenic
947227910 2:227857808-227857830 TCTGGGGACCCTCTCCCACCTGG + Intergenic
1175271496 20:57737166-57737188 TCTGGCCACACTGACCCACGTGG + Intergenic
1176287914 21:5028596-5028618 TCAGGGGACACACGCCCAAGAGG - Intronic
1179507116 21:41848692-41848714 GCTGGAGACAATGGCCCACGTGG - Intronic
1179869267 21:44234879-44234901 TCAGGGGACACACGCCCAAGAGG + Intronic
1180038000 21:45260070-45260092 TCTGGTAACACTGGCTCATGGGG - Intergenic
953966968 3:47315684-47315706 TCTGGTGACACTTGGCTAGGGGG - Intronic
957574630 3:81991362-81991384 TCTGGGGACACCCTCCCACCTGG - Intergenic
967094309 3:186164085-186164107 TCTGATGACACTTGCCCAGGAGG + Intronic
968428491 4:538382-538404 TCTGGGGACACTGGCCCAGCGGG - Intronic
986859985 5:11915807-11915829 TGTGGTCACACTGGCCCACCTGG - Intergenic
991600193 5:68344272-68344294 TCTGGTTAGACTCACCCAAGTGG - Intergenic
992569708 5:78042949-78042971 TCTGATGACATTCACCCAGGAGG - Intronic
1001031065 5:168263294-168263316 TCTGGTGACGCTGGCCCTCGCGG - Intronic
1003615747 6:7653827-7653849 ACTGGTGACACGCGTCCACCTGG - Intergenic
1010519071 6:76810389-76810411 TTTGGTAACACACGCCCACTTGG + Intergenic
1022270725 7:28805189-28805211 CCTGGTGACTCTCACCCACTGGG - Intronic
1029821710 7:103152895-103152917 TCTGGTCACAGTCTCCCACAGGG - Intergenic
1035032405 7:155870038-155870060 TATGGTGACCCTGGCCCATGAGG - Intergenic
1035294842 7:157861191-157861213 CATGGTGACACTGCCCCACGGGG + Intronic
1038871991 8:31504656-31504678 TCAGCTGACACCTGCCCACGAGG - Intergenic
1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG + Intronic
1041421072 8:57667469-57667491 TCTCTTGACACTGGCCCAGGTGG + Intergenic
1047218641 8:122900397-122900419 TAGAGTGAGACTCGCCCACGAGG + Intronic
1048443227 8:134475353-134475375 TCTGCTCACACTTGGCCACGTGG + Intergenic
1052616647 9:30851139-30851161 TCTGGGGACCCTCTCCCACCTGG - Intergenic
1056942151 9:90964940-90964962 TCTGCTCACACTCCCCCAAGGGG + Intergenic
1062633472 9:137477972-137477994 TGTGGTGACAGTCGCCCCCTCGG - Intronic
1186489367 X:9959549-9959571 TGTGATGACACTAGCCCACCTGG + Intergenic
1190440146 X:50469095-50469117 TCTTCTGGCACTCGCCCAAGGGG - Intronic
1201625059 Y:16005801-16005823 TCTGATGACACTGGACCACCTGG - Intergenic