ID: 1161473671

View in Genome Browser
Species Human (GRCh38)
Location 19:4473243-4473265
Sequence CGCCAATGGTCTGGGGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161473665_1161473671 -7 Left 1161473665 19:4473227-4473249 CCTGAAGGAGCTGCGGCGCCAAT 0: 1
1: 0
2: 1
3: 2
4: 61
Right 1161473671 19:4473243-4473265 CGCCAATGGTCTGGGGGTCCTGG 0: 1
1: 0
2: 1
3: 5
4: 98
1161473659_1161473671 20 Left 1161473659 19:4473200-4473222 CCGTGGGGATCTGGGGGGTGTCC 0: 1
1: 0
2: 2
3: 22
4: 273
Right 1161473671 19:4473243-4473265 CGCCAATGGTCTGGGGGTCCTGG 0: 1
1: 0
2: 1
3: 5
4: 98
1161473664_1161473671 -1 Left 1161473664 19:4473221-4473243 CCAGGGCCTGAAGGAGCTGCGGC 0: 1
1: 1
2: 1
3: 50
4: 357
Right 1161473671 19:4473243-4473265 CGCCAATGGTCTGGGGGTCCTGG 0: 1
1: 0
2: 1
3: 5
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161473671 Original CRISPR CGCCAATGGTCTGGGGGTCC TGG Intronic
901703298 1:11056785-11056807 GGCCAAGGGGCTGGGGGACCTGG + Intronic
902032268 1:13431457-13431479 CTCCAATGGTTTGGGTGCCCAGG - Intergenic
902546432 1:17193420-17193442 GGAAAATAGTCTGGGGGTCCTGG + Intergenic
902726170 1:18337664-18337686 CCCCAAAGGTCTGCGTGTCCTGG + Intronic
904434397 1:30484900-30484922 GGCCTATGGTCTGGGTCTCCAGG + Intergenic
904455752 1:30647066-30647088 CTCTAATGGGCTGGGGGGCCTGG + Intergenic
905281507 1:36852386-36852408 GGGCAATGGCCTGGAGGTCCAGG + Intronic
905404360 1:37723119-37723141 CCCCACAGCTCTGGGGGTCCAGG + Exonic
908447640 1:64216070-64216092 AGCTAATGGACTGGGAGTCCTGG - Intronic
916211154 1:162360948-162360970 CGCCAATGGTCTGGTGTGGCTGG + Intronic
916605362 1:166337345-166337367 AGCCAATGGTCCTAGGGTCCAGG + Intergenic
921010132 1:211133480-211133502 CGCGAAGGCTCTGGGGCTCCCGG - Intronic
924949336 1:248867799-248867821 CTCCAGTGGACTCGGGGTCCAGG + Intergenic
1070415001 10:76181098-76181120 TTCCAATGGGCTGGGGATCCAGG - Intronic
1070840980 10:79487727-79487749 CGCCCATGGTCTGGCTGTGCAGG + Intergenic
1076538429 10:131198134-131198156 GCCCAATGGTCTGGGCATCCTGG + Intronic
1076869700 10:133187299-133187321 AGCCAGTGTTCTGGGGGGCCTGG + Intronic
1077021128 11:417586-417608 CCCCAAGGCTCTGGGGCTCCGGG - Intergenic
1077918880 11:6628681-6628703 TGGTAAGGGTCTGGGGGTCCTGG + Exonic
1083571983 11:63765888-63765910 GGCCGAGGGCCTGGGGGTCCAGG - Exonic
1083742171 11:64716793-64716815 CCCCAAGGGTCTGTGGATCCCGG - Intronic
1084387738 11:68854753-68854775 CGCAGAGGGGCTGGGGGTCCAGG + Intergenic
1084473797 11:69377619-69377641 CGCCAATGCTGTGGGGGGCAGGG + Intergenic
1084876494 11:72137390-72137412 CTCCCAGGGTCTGGAGGTCCAGG - Intronic
1085279523 11:75320827-75320849 GCCCAGTGGTCTGGGAGTCCAGG - Intronic
1085409657 11:76283562-76283584 CCCCCAGGGTCTGTGGGTCCCGG + Intergenic
1086860052 11:91915411-91915433 CTCCACTGGTCTGGGGTTTCTGG + Intergenic
1089378778 11:118013109-118013131 AGCCTATGGTATGGGAGTCCTGG - Intergenic
1089959677 11:122604747-122604769 CGGCAGTGGGCTGGGGGTTCAGG + Intergenic
1090768963 11:129902393-129902415 GGCTGTTGGTCTGGGGGTCCAGG + Exonic
1103330590 12:120151241-120151263 CGCCTATGGCCTGGCGGGCCTGG - Exonic
1103728167 12:123009289-123009311 AGCAGATGGCCTGGGGGTCCTGG - Intronic
1112050737 13:95642138-95642160 GGCCTAAGGTCTGGGCGTCCAGG + Exonic
1113804964 13:113107233-113107255 CTCCAAGGGTGTGGGTGTCCCGG + Intronic
1121645767 14:95516457-95516479 CGCCGAAAGTCTGGGGGACCTGG - Intronic
1122898317 14:104771520-104771542 CTCCAAGGGTATGGGGGGCCTGG - Intronic
1130125270 15:81088653-81088675 CTCATATGGTCTGGGGCTCCAGG + Intronic
1132764892 16:1529311-1529333 TGCCAAGCGTCTGGGGGGCCGGG + Intronic
1133205037 16:4228112-4228134 CACCAATGGTCAGGGAGGCCCGG - Intronic
1136487953 16:30585365-30585387 CACCGACGGACTGGGGGTCCCGG + Intronic
1136873026 16:33825173-33825195 CGCCAAGGGTGCGGGGTTCCTGG - Intergenic
1203099146 16_KI270728v1_random:1290882-1290904 CGCCAAGGGTGCGGGGTTCCTGG + Intergenic
1142887090 17:2919618-2919640 GGCCCATGGTCTGGGGGGTCTGG + Intronic
1143393076 17:6571629-6571651 TGACAAGGGCCTGGGGGTCCCGG + Intergenic
1144427095 17:15153451-15153473 TGCCAATGGTCAGGAGGTCACGG - Intergenic
1149943680 17:60898840-60898862 CTGCAGTGGTCTGGGGGTTCGGG + Intronic
1150998002 17:70341200-70341222 CACCAATGATCTGGGAATCCTGG - Intergenic
1151669504 17:75564312-75564334 CGGCAGTGGGCTGGGGCTCCTGG - Intronic
1152922735 17:83073890-83073912 CCCCACTGGGCTGGGTGTCCCGG - Intergenic
1153975467 18:10264888-10264910 CGCCAATGGTGTGGGGGAGCAGG + Intergenic
1155584653 18:27351346-27351368 GGCCAATGGCCAGGGGCTCCTGG - Intergenic
1160531464 18:79567494-79567516 CGCCCCTGGTCAGGGGGTGCTGG + Intergenic
1160814015 19:1027078-1027100 CGACAACGCTCTGGGGGTCTGGG + Intronic
1160919570 19:1513356-1513378 CGCCCTGGGTCTGGGAGTCCCGG + Intronic
1161077787 19:2294687-2294709 CGCCAATGCTCCGTGGGTCCTGG + Intronic
1161473621 19:4473091-4473113 CGCCGACGGTCTGGGGGTCCCGG + Intronic
1161473671 19:4473243-4473265 CGCCAATGGTCTGGGGGTCCTGG + Intronic
1161606760 19:5219401-5219423 CCACGATGGGCTGGGGGTCCGGG + Exonic
1162391221 19:10391295-10391317 TGCCAAAGGCCCGGGGGTCCGGG - Exonic
1163104440 19:15115395-15115417 AGCCATGGGTCTGGGGGCCCGGG - Exonic
1163308302 19:16496333-16496355 CGCCATTGGTCTGCGGGGCGCGG + Exonic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1166368049 19:42287110-42287132 CCCAAAGGGTGTGGGGGTCCGGG - Exonic
1167115596 19:47487547-47487569 CGCCCAGAGTCTGGGGGACCAGG + Intergenic
925924403 2:8659899-8659921 CCCCAGTGGTCTGGACGTCCTGG + Intergenic
926433078 2:12809748-12809770 CTCCAATGGGATGGGGGACCAGG - Intergenic
932779067 2:74548933-74548955 CGCCCAGGGTCCGGGGGCCCGGG - Intronic
934714831 2:96537430-96537452 CGCCGATGGTCCGGGGAGCCCGG + Intronic
1168993548 20:2115223-2115245 AGCCAATGGTCTGAGAGTTCTGG - Intronic
1173799928 20:45888704-45888726 AGCCACAGGTCTGGGGCTCCAGG + Exonic
1174204257 20:48827782-48827804 CGCCAGGGGCCCGGGGGTCCGGG + Exonic
1178431317 21:32520789-32520811 CGTCAGTGGTCCAGGGGTCCAGG - Intergenic
1184665217 22:45985188-45985210 TGCCATAGGACTGGGGGTCCTGG - Intergenic
1184892591 22:47388997-47389019 CGCCAGTGGCTTGGGAGTCCTGG + Intergenic
1185319086 22:50192267-50192289 CGCCGATGCTCTGTGGGTCTTGG + Intronic
950609769 3:14118596-14118618 CTCCAGTGGGTTGGGGGTCCTGG - Intronic
960131416 3:114060297-114060319 AGCCAATGGTCTGGGCTTCCAGG + Intronic
963412889 3:144954152-144954174 AGCCTTTGGTCTGTGGGTCCAGG + Intergenic
968047028 3:195630256-195630278 AGCCGAAGGTCTGAGGGTCCTGG + Intergenic
968307622 3:197659788-197659810 AGCCGAAGGTCTGAGGGTCCTGG - Intergenic
969202400 4:5616381-5616403 CGTGAATGGTCTGGGAGCCCTGG + Intronic
976123163 4:81805053-81805075 TGCCAAGGGCCTGGGAGTCCCGG - Intronic
995462650 5:112419634-112419656 CGCCCATGGTCGGGGCGTCGTGG - Intergenic
996292228 5:121865960-121865982 TGCCAGTGGTCTGGGTGTCTGGG - Intergenic
997412691 5:133702404-133702426 CCCCAATGCTCTGAGGTTCCAGG - Intergenic
998469943 5:142375768-142375790 AGTGCATGGTCTGGGGGTCCAGG - Intergenic
1002661123 5:180791759-180791781 CGCCAAGGCTCTGGGTGTCATGG - Exonic
1002762132 6:210328-210350 GGCCAATGGTCTGAGGGTGTGGG - Intergenic
1006722378 6:36165127-36165149 CGCCAAGAGTCTGGGGAACCTGG - Intergenic
1015935315 6:138402695-138402717 CGCCCTTGGCCTGGGGCTCCTGG + Intergenic
1019894856 7:3975860-3975882 CGGCAGTGGTGCGGGGGTCCTGG + Intronic
1024291192 7:47805736-47805758 GGCCTCTGGTCTTGGGGTCCTGG - Intronic
1029458236 7:100681692-100681714 AGCCCAGGGGCTGGGGGTCCGGG + Exonic
1031573380 7:123386325-123386347 TGCCAATGATATGGGGGTCCTGG + Intergenic
1035544223 8:467086-467108 TGTCCATGGTCTGGTGGTCCTGG + Intronic
1035720363 8:1786699-1786721 CGCCTGTGCTCTGGGGTTCCTGG - Intergenic
1037719198 8:21428591-21428613 TCTCAATGGTCTGGGGGCCCTGG - Intergenic
1039843427 8:41309303-41309325 CGCCACTGGCCGGGGGGACCGGG - Exonic
1052188651 9:25629956-25629978 AGCTGATGGTCTGGGGGTCTAGG + Intergenic
1053345405 9:37374531-37374553 TGCCATTGGTCTGGGGGTGCAGG - Intergenic
1062352228 9:136144843-136144865 CGGCACTGGACTGGAGGTCCCGG - Intergenic
1062446692 9:136598230-136598252 CGCCATTGCGCTGGGGGCCCAGG + Intergenic
1186656128 X:11614007-11614029 TGCCAGTGGTCTGGGAGCCCTGG - Intronic
1187950841 X:24468532-24468554 TGTAAATGGTCTGGGGGTGCTGG + Intronic
1190913067 X:54789592-54789614 CTCAAATGGCCTGTGGGTCCAGG + Intronic