ID: 1161474344

View in Genome Browser
Species Human (GRCh38)
Location 19:4475772-4475794
Sequence TGTCATCACCATGAATGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 134}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161474344_1161474359 23 Left 1161474344 19:4475772-4475794 CCACCCCATTCATGGTGATGACA 0: 1
1: 0
2: 2
3: 17
4: 134
Right 1161474359 19:4475818-4475840 GTCCCCTGGGTGGAGGGGAACGG 0: 1
1: 0
2: 7
3: 64
4: 731
1161474344_1161474356 17 Left 1161474344 19:4475772-4475794 CCACCCCATTCATGGTGATGACA 0: 1
1: 0
2: 2
3: 17
4: 134
Right 1161474356 19:4475812-4475834 CCCAGTGTCCCCTGGGTGGAGGG 0: 1
1: 0
2: 6
3: 48
4: 367
1161474344_1161474358 18 Left 1161474344 19:4475772-4475794 CCACCCCATTCATGGTGATGACA 0: 1
1: 0
2: 2
3: 17
4: 134
Right 1161474358 19:4475813-4475835 CCAGTGTCCCCTGGGTGGAGGGG 0: 1
1: 0
2: 4
3: 30
4: 361
1161474344_1161474353 13 Left 1161474344 19:4475772-4475794 CCACCCCATTCATGGTGATGACA 0: 1
1: 0
2: 2
3: 17
4: 134
Right 1161474353 19:4475808-4475830 ATTGCCCAGTGTCCCCTGGGTGG 0: 2
1: 11
2: 89
3: 300
4: 714
1161474344_1161474354 16 Left 1161474344 19:4475772-4475794 CCACCCCATTCATGGTGATGACA 0: 1
1: 0
2: 2
3: 17
4: 134
Right 1161474354 19:4475811-4475833 GCCCAGTGTCCCCTGGGTGGAGG 0: 1
1: 1
2: 11
3: 63
4: 415
1161474344_1161474352 10 Left 1161474344 19:4475772-4475794 CCACCCCATTCATGGTGATGACA 0: 1
1: 0
2: 2
3: 17
4: 134
Right 1161474352 19:4475805-4475827 GTCATTGCCCAGTGTCCCCTGGG 0: 2
1: 6
2: 45
3: 253
4: 869
1161474344_1161474360 24 Left 1161474344 19:4475772-4475794 CCACCCCATTCATGGTGATGACA 0: 1
1: 0
2: 2
3: 17
4: 134
Right 1161474360 19:4475819-4475841 TCCCCTGGGTGGAGGGGAACGGG 0: 1
1: 1
2: 4
3: 28
4: 331
1161474344_1161474351 9 Left 1161474344 19:4475772-4475794 CCACCCCATTCATGGTGATGACA 0: 1
1: 0
2: 2
3: 17
4: 134
Right 1161474351 19:4475804-4475826 AGTCATTGCCCAGTGTCCCCTGG 0: 2
1: 4
2: 50
3: 322
4: 988

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161474344 Original CRISPR TGTCATCACCATGAATGGGG TGG (reversed) Intronic
902107045 1:14046638-14046660 TCTCATGACCCTGAATGGTGGGG + Intergenic
902462762 1:16591121-16591143 TGTAATCACCACTAATCGGGAGG - Intronic
903301924 1:22385356-22385378 TGACATCACCAGGGGTGGGGAGG + Intergenic
903569070 1:24291100-24291122 TGTCATCACCACCTGTGGGGGGG - Intergenic
904090405 1:27941081-27941103 TGTCAGGACCATGGATGGGGAGG - Intronic
904866695 1:33584919-33584941 CGTCATCACCATGAGTGGGAGGG + Intronic
904868849 1:33603706-33603728 TGTCATCATCATGAATGCCACGG + Intronic
907157312 1:52346314-52346336 TGTTAACACTATTAATGGGGTGG + Exonic
909257579 1:73444117-73444139 TGTCCTCACATTGAATGGGTGGG + Intergenic
913163034 1:116162526-116162548 TGTCATCACAATGGATGGGGTGG - Intergenic
913602714 1:120437401-120437423 TGTAATCACCACTAATCGGGAGG + Intergenic
913603462 1:120443754-120443776 TGTAATCACCACTAATCGGGAGG + Intergenic
913640316 1:120806469-120806491 TGTAATCACCACTAATCGGGAGG + Intronic
914190340 1:145404378-145404400 TGTAATCACCACTAATCGGGTGG - Intronic
914212197 1:145590160-145590182 TGTAATCACCACTAATCGGGAGG - Intergenic
914278161 1:146143869-146143891 TGTAATCACCACTAATCGGGAGG - Intronic
914363886 1:146961022-146961044 TGTAATCACCACTAATCGGGTGG + Intronic
914487788 1:148126120-148126142 TGTAATCACCACTAATCGGGAGG - Intronic
914539207 1:148594817-148594839 TGTAATCACCACTAATCGGGAGG - Intronic
914588144 1:149081239-149081261 TGTAATCACCACTAATCGGGAGG - Intronic
914627471 1:149476811-149476833 TGTAATCACCACTAATCGGGAGG + Intergenic
915273482 1:154772276-154772298 TGTACTCGCCAGGAATGGGGTGG + Exonic
918164365 1:181930375-181930397 TGTCACCACGATGAATGGTGAGG + Intergenic
919983759 1:202658773-202658795 TGCCAGCACCCTGAATTGGGAGG - Intronic
1063964414 10:11335543-11335565 TGGCATCACCATCACTGAGGCGG - Exonic
1069105407 10:64377942-64377964 TGTCTTCATCATTAATGGGCAGG - Intergenic
1070215643 10:74377646-74377668 TGTCAAAACCATGAAAAGGGAGG + Intronic
1070888263 10:79923315-79923337 TGTCTTCACCATGAAATGAGAGG - Intergenic
1070972673 10:80580460-80580482 TGTCAAAACCATGAAAAGGGAGG + Intronic
1074562618 10:114547546-114547568 TTTCAGCACCATTGATGGGGTGG + Intronic
1076573299 10:131446760-131446782 TGTCATGAAGATGAAAGGGGTGG - Intergenic
1077166345 11:1141158-1141180 TTTCAACACCAGGGATGGGGTGG - Intergenic
1077724562 11:4661334-4661356 TGTCATCATCAGGATTGGGCTGG - Intergenic
1083010730 11:59396078-59396100 TGTCATTAATATGAAAGGGGAGG + Intergenic
1083954166 11:65973959-65973981 AGTCATGACCATGGATGGGGAGG + Intronic
1087107152 11:94422279-94422301 TCTCCCCACCATGAATGAGGAGG - Intronic
1091110527 11:132962331-132962353 TGTCTTCATCATGATGGGGGAGG - Intronic
1092935146 12:13354992-13355014 TGTAATCCCCATGATTTGGGAGG + Intergenic
1097817283 12:64089154-64089176 TGTCAGAACCATGAAGGAGGTGG - Intronic
1102988024 12:117294325-117294347 TTTCATCACCAGGGAGGGGGAGG + Intronic
1104099678 12:125595187-125595209 TGGCAGCTCCATGAAGGGGGAGG + Intronic
1104725414 12:131072594-131072616 TGTCAGCACCATGTGTGTGGGGG + Intronic
1107819472 13:44273267-44273289 TGTCATCACCAAAGATGGGATGG - Intergenic
1107848564 13:44546353-44546375 TGACATCACCAATAATGGGATGG + Intronic
1112876262 13:104043354-104043376 TGTCTTCAGCATAAATGTGGTGG - Intergenic
1115428521 14:33289383-33289405 TGTCATCACCATGTTTTGGCAGG - Intronic
1118438979 14:65795894-65795916 TGCCATGAGAATGAATGGGGAGG + Intergenic
1119096145 14:71833526-71833548 TGTCATGACCATGTAGGGGTGGG - Intergenic
1119808037 14:77495525-77495547 TGTCATCTCCATGTAGGAGGAGG + Intronic
1120759722 14:88274639-88274661 TGTTATCACCATTATTGGGTGGG - Intronic
1122698747 14:103572606-103572628 TGTGATCCCCATGACTTGGGAGG + Intronic
1123007623 14:105331876-105331898 TGTGATCACCAAGTATGAGGGGG - Intronic
1123434618 15:20246192-20246214 TGTAAACTCCATGAATGTGGGGG - Intergenic
1123983843 15:25626752-25626774 TGTCATCCCCAGGAATCAGGGGG - Intergenic
1124162262 15:27283191-27283213 TGCCAGCACCATGAAGGGGTTGG + Intronic
1125601670 15:40918900-40918922 TGTCGTCACCCTGTCTGGGGGGG - Intergenic
1128645706 15:69377357-69377379 TGTCATCAGCCTTAGTGGGGTGG + Intronic
1130839335 15:87682954-87682976 AGGAATCACCATGAATGGGAGGG + Intergenic
1132553160 16:561432-561454 TGTCATCCACATGGGTGGGGGGG + Intronic
1133866092 16:9644714-9644736 TGTCCTAACCAGGAGTGGGGAGG - Intergenic
1134808412 16:17145519-17145541 TCTCATCACCATGAATATAGAGG + Intronic
1135482003 16:22828368-22828390 CCTCATCAGCATGTATGGGGAGG + Intronic
1136471521 16:30483881-30483903 TATCATCATCACGGATGGGGAGG + Exonic
1136850004 16:33604912-33604934 TGTAAACTCCATGAATGTGGGGG + Intergenic
1138766708 16:59613906-59613928 TGTCATCACCATGACAAGGCTGG + Intergenic
1203111616 16_KI270728v1_random:1453365-1453387 TGTAAACTCCATGAATGTGGGGG + Intergenic
1143243096 17:5460805-5460827 TGTCATCAAGATGAATAAGGAGG - Intronic
1149240787 17:54646317-54646339 TGGCATCATAATAAATGGGGGGG + Intergenic
1150207742 17:63421507-63421529 TATGATCCCCATGAATGGTGTGG - Exonic
1156176297 18:34551092-34551114 TGTCATCACTATGAATAGACTGG + Intronic
1159372333 18:67544648-67544670 ACTCATTACCATGGATGGGGAGG + Intergenic
1161474344 19:4475772-4475794 TGTCATCACCATGAATGGGGTGG - Intronic
1161583792 19:5094415-5094437 TTTCATCACCATGTGCGGGGGGG + Intronic
1162059123 19:8084097-8084119 TGGCATCAACAGGACTGGGGAGG - Intronic
1164380951 19:27736698-27736720 TATCATTACAATGATTGGGGTGG + Intergenic
1165030848 19:32997315-32997337 TGTAAACTCCATGAATGTGGGGG - Intronic
1167387266 19:49171385-49171407 TCTCATCACCATCAATCAGGAGG - Exonic
1168394556 19:56037329-56037351 TGTCATCTCCATGAAGGTGGAGG - Intronic
1202678425 1_KI270711v1_random:28553-28575 TGTAATCACCACTAATCGGGAGG - Intergenic
926315127 2:11704095-11704117 TGGCATCCCCCAGAATGGGGAGG + Intronic
928245776 2:29625857-29625879 TGTCATCACCAAGAGGGTGGTGG + Intronic
928302311 2:30136781-30136803 TGTATCCCCCATGAATGGGGGGG - Intergenic
932242298 2:70166940-70166962 GGTCAGCACCATGAATGCTGAGG + Intronic
935918307 2:107983240-107983262 TGTCATCAAGATCATTGGGGAGG + Intergenic
936348004 2:111689751-111689773 TGTCATCACCATGACAGGGAAGG + Intergenic
938344666 2:130558550-130558572 CCTCATCACCATGGCTGGGGAGG - Intergenic
938345167 2:130562170-130562192 CCTCATCACCATGGCTGGGGAGG + Intergenic
943766646 2:191670192-191670214 TGTCATTAACAGAAATGGGGAGG - Intergenic
944649270 2:201812510-201812532 AGTCATCAGCATGAATGCAGAGG + Exonic
946537897 2:220651211-220651233 TGTCAGCACCAGGTAGGGGGAGG + Intergenic
1172563919 20:35913379-35913401 TTTCCTTACTATGAATGGGGAGG + Intronic
1174503846 20:51004305-51004327 TGTCATCACCATGACGACGGTGG - Exonic
1178811669 21:35888130-35888152 TGTCATCACTCTAAATGTGGTGG + Intronic
1180035601 21:45246659-45246681 TACCCTCACCATTAATGGGGAGG - Intergenic
953333201 3:42071765-42071787 TGTCATCACTCTGAATGGCAGGG - Intronic
956310636 3:67875470-67875492 TGTGATCATCATAAATTGGGTGG - Intergenic
958516016 3:95116978-95117000 TGTCATCCCCATGCTTTGGGAGG - Intergenic
959513885 3:107244336-107244358 TGGCATTACTATGATTGGGGTGG - Intergenic
962017807 3:131460657-131460679 TATCATGGCCATGAATGGGAAGG - Intergenic
962356089 3:134695436-134695458 GGTCATCACCATGTATGGGCAGG - Intronic
964769063 3:160205357-160205379 TGCCATCACCAGGAAAAGGGTGG - Intergenic
966212309 3:177466094-177466116 TGTCACCACCATGACTGATGAGG - Intergenic
969415133 4:7053017-7053039 AGTCATCAGCCTGGATGGGGTGG + Intronic
969890960 4:10259682-10259704 TGTCATCACCAGGAATTGGTAGG - Intergenic
970350216 4:15194949-15194971 TGTCCTCACCATTGATGTGGAGG - Intergenic
975040068 4:69735516-69735538 TGTCATCACTGTGAATGGGTGGG - Intronic
975380803 4:73698571-73698593 TGTCAGCCCCATGAATTAGGAGG - Intergenic
976074002 4:81276143-81276165 TGTTATCAACATGAAAAGGGGGG + Intergenic
977093320 4:92706966-92706988 TATAATCACCATGAATGTGATGG - Intronic
978104139 4:104881421-104881443 TATCATCATCATCATTGGGGAGG - Intergenic
980293779 4:130881956-130881978 TGTCATCCCCATGATTTGGGAGG + Intergenic
980546905 4:134276125-134276147 TGTCTTCACACTGAATGGGCTGG + Intergenic
980765989 4:137304938-137304960 TGTGATCCCCATTGATGGGGAGG - Intergenic
981702730 4:147624728-147624750 TGTGAGTACCATGAATGGAGTGG + Intronic
982354126 4:154448196-154448218 TGTCATAGCCAGGAATGGGAGGG - Intronic
983963568 4:173783389-173783411 TGCCATCACCATGAGTTGAGGGG + Intergenic
985769071 5:1797727-1797749 TGTCATCAACATGAATTTGGGGG - Intergenic
987301556 5:16602246-16602268 AGTCAACATCCTGAATGGGGAGG - Intronic
988295039 5:29347046-29347068 TGGCATCACCATGGATGGGTGGG - Intergenic
991589246 5:68231851-68231873 AGTCAGCACCATAAATTGGGTGG - Intronic
1001835612 5:174828984-174829006 TCTCATTGCCAGGAATGGGGAGG - Intergenic
1003504419 6:6728053-6728075 TGTCTTCACCTGGAGTGGGGGGG - Intergenic
1004426037 6:15507821-15507843 TGTGGTCACCATGAATGTGAAGG + Intronic
1007635787 6:43298945-43298967 TATCATCATCATTAATTGGGAGG + Intronic
1011508296 6:88072176-88072198 TGTTGTCAGAATGAATGGGGAGG + Intergenic
1013455123 6:110323420-110323442 TGTCATCACCAGGGCTGGGGAGG + Intronic
1017610059 6:156176073-156176095 TGTTAACATCATGAATGGTGTGG + Intergenic
1020807550 7:12808873-12808895 TCCCATCACCATCAATGGGTTGG - Intergenic
1021938223 7:25652701-25652723 TGTCAGCACCATGCATGGTGTGG + Intergenic
1023621092 7:42073994-42074016 TGTGATCACCTTGAAAGTGGAGG - Intronic
1024619090 7:51142103-51142125 ACTGATCACCATGAATGGGCAGG + Intronic
1026256393 7:68715805-68715827 TGTCATCCCCATGTAAGGGTGGG + Intergenic
1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG + Exonic
1033169724 7:139072937-139072959 TTTCCTCACCATGAGAGGGGAGG - Intronic
1033573636 7:142658491-142658513 TGTCATGACAATGAATGCGAAGG - Intergenic
1037626476 8:20611650-20611672 TGTCTTCATGATGAATAGGGTGG + Intergenic
1041390185 8:57341026-57341048 TGCCATCGCCATGACTGAGGTGG + Intergenic
1043488285 8:80720628-80720650 TGTCAAAACCATGGATGGGTGGG + Intronic
1043862556 8:85337202-85337224 TGTCATCCTCATGGATGTGGGGG - Intronic
1045079176 8:98605524-98605546 TGTTATCACCATAAATGGGCAGG - Intronic
1045394986 8:101751582-101751604 TAACATCTCCATGAAAGGGGAGG + Intronic
1046102688 8:109632820-109632842 TGTCATTACCATGAATGAGGGGG + Intronic
1046606990 8:116382374-116382396 TGGCCTCAGCATGAATGTGGTGG - Intergenic
1048409623 8:134158925-134158947 TGGCATCACAAAGAATGGAGAGG - Intergenic
1049320574 8:141994132-141994154 TGTCCTGACCATGCATGGGCTGG + Intergenic
1052886236 9:33650870-33650892 TGTCATGACAATGAATGGGAAGG - Intergenic
1058843887 9:108936474-108936496 TGTCATTACCATGAATATAGAGG - Intronic
1059306079 9:113354284-113354306 TGCCATCACCAAGTATGTGGCGG + Exonic
1059838168 9:118180793-118180815 TGTGATCACCAGGAAAGGGGTGG - Intergenic
1061497078 9:130981290-130981312 TGCCATTACCATGCCTGGGGTGG - Intergenic
1062277973 9:135739571-135739593 TGTGAACACCATGAAGAGGGTGG - Intronic
1189109237 X:38270282-38270304 TCTCATCTACAGGAATGGGGAGG - Intronic
1190459206 X:50654703-50654725 GGTGGTCACCAGGAATGGGGCGG - Intronic
1202111745 Y:21427905-21427927 TGTCATCACCAATAGTGAGGTGG - Intergenic