ID: 1161474567

View in Genome Browser
Species Human (GRCh38)
Location 19:4477095-4477117
Sequence AAGACCCCAGGTTCTCAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 165}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161474567_1161474576 21 Left 1161474567 19:4477095-4477117 CCTGTTTGAGAACCTGGGGTCTT 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1161474576 19:4477139-4477161 TCCTTTGTTTCGGCCTGGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 98
1161474567_1161474578 22 Left 1161474567 19:4477095-4477117 CCTGTTTGAGAACCTGGGGTCTT 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1161474578 19:4477140-4477162 CCTTTGTTTCGGCCTGGGCTGGG 0: 1
1: 0
2: 1
3: 8
4: 150
1161474567_1161474579 25 Left 1161474567 19:4477095-4477117 CCTGTTTGAGAACCTGGGGTCTT 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1161474579 19:4477143-4477165 TTGTTTCGGCCTGGGCTGGGTGG 0: 1
1: 0
2: 0
3: 15
4: 215
1161474567_1161474572 11 Left 1161474567 19:4477095-4477117 CCTGTTTGAGAACCTGGGGTCTT 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1161474572 19:4477129-4477151 TCTGTGCCTCTCCTTTGTTTCGG 0: 1
1: 1
2: 2
3: 32
4: 378
1161474567_1161474575 17 Left 1161474567 19:4477095-4477117 CCTGTTTGAGAACCTGGGGTCTT 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1161474575 19:4477135-4477157 CCTCTCCTTTGTTTCGGCCTGGG 0: 1
1: 0
2: 1
3: 10
4: 117
1161474567_1161474573 16 Left 1161474567 19:4477095-4477117 CCTGTTTGAGAACCTGGGGTCTT 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161474567 Original CRISPR AAGACCCCAGGTTCTCAAAC AGG (reversed) Intronic
900371158 1:2332829-2332851 AGGACCCCAGGGTCTCAGAGGGG + Intronic
900413296 1:2523520-2523542 AAGAACCCAGGGCCTGAAACTGG - Intronic
903083022 1:20827654-20827676 AAGACCCCAGCTCTTCCAACAGG + Exonic
903947482 1:26972777-26972799 GAGACCCCAGGCTCTCAGGCTGG - Intergenic
904076343 1:27845471-27845493 AAGAGCACAGGCTCTGAAACCGG + Intronic
907608423 1:55842964-55842986 AAGACCACAGGGTTTCAGACTGG + Intergenic
911617764 1:100033520-100033542 AAGACCCCATGTTGTGAAAGAGG - Intergenic
911828531 1:102519799-102519821 AATACCCCAGCTGCTCAACCTGG + Intergenic
915330792 1:155111170-155111192 GAAACCCCAGGTTCCCAAGCTGG - Intergenic
919650712 1:200146691-200146713 CAGACCTATGGTTCTCAAACTGG + Intronic
919812448 1:201417652-201417674 AAGAGACCAGGTCCTCAAACAGG - Intronic
923719446 1:236454594-236454616 AAGATGCCAAGTTGTCAAACTGG - Intronic
923923151 1:238592689-238592711 AAGGCCTCAGGTGTTCAAACAGG + Intergenic
924004855 1:239598165-239598187 AAGACCCCAGGATCTTAGAAAGG + Intronic
1066467308 10:35664391-35664413 AAGACCACAGGTTGTGAAAATGG + Intergenic
1071713485 10:88072502-88072524 GAGACCACAGGTTCTAAGACAGG + Intergenic
1076037393 10:127211467-127211489 AAGACCCCAAATTCACTAACAGG - Intronic
1078273394 11:9818559-9818581 AAGACTAAAGCTTCTCAAACAGG - Intronic
1079654843 11:22974583-22974605 AGGTACCCAGGTTCTCACACTGG - Intergenic
1079860541 11:25664728-25664750 AAGACCTTAGGTTCTGGAACTGG + Intergenic
1081680606 11:44999778-44999800 AACACCCCAGTTTCAGAAACGGG - Intergenic
1086335285 11:85794569-85794591 AAGAATCCAGATTCTCAAATGGG + Intronic
1087018301 11:93576245-93576267 AAGACCAGAGGTTCTCAGACTGG + Intergenic
1087991281 11:104747208-104747230 AAGAACCCAGGCTGTCACACTGG + Intergenic
1091091121 11:132772413-132772435 GAAATCCCAGGTTCTCAAATAGG - Intronic
1091269117 11:134293305-134293327 AAGACCGCAGGTTTTCACCCTGG + Intronic
1092980828 12:13792669-13792691 AAGACCGCAGGGTCTGAAAGAGG + Intronic
1093541584 12:20293472-20293494 AATACCACAGGTTCTCTAAGTGG - Intergenic
1093670733 12:21871841-21871863 TAGACCAGTGGTTCTCAAACGGG - Intronic
1100230511 12:92601886-92601908 CAGACACCACGTCCTCAAACTGG + Intergenic
1100767186 12:97880236-97880258 AACACCGCATATTCTCAAACAGG + Intergenic
1102714347 12:114956997-114957019 AAGAGCCCAGATTCTTCAACAGG - Intergenic
1103336214 12:120191974-120191996 AAGTCCCCAGTTTCACATACAGG + Intronic
1104426266 12:128680978-128681000 CAGACACCTGGGTCTCAAACTGG - Intronic
1104898800 12:132176821-132176843 TAGACCCCTGATTCTCAAAGTGG + Intergenic
1107187068 13:37535830-37535852 AAGACCAGTAGTTCTCAAACAGG + Intergenic
1109680858 13:65749953-65749975 AATACCACATGTTCTCAAAGTGG - Intergenic
1118709943 14:68510701-68510723 AAGCCTCCACATTCTCAAACAGG - Intronic
1119677822 14:76569156-76569178 TAGACCAGAGGTTCTCAACCAGG + Intergenic
1121899890 14:97684376-97684398 GAGATCCCAGGTTCTCCAACAGG + Intergenic
1122970893 14:105151808-105151830 AAGCCCACAGGTTCCCAAGCTGG + Intronic
1123966606 15:25466033-25466055 AAGAACCCAGGTACTGAACCTGG - Intergenic
1124410795 15:29434916-29434938 AAGACTCGAGTTTCTCAAAATGG + Intronic
1125052159 15:35312402-35312424 AAAACCCCAGGATCTCAACTGGG + Intronic
1126700371 15:51361417-51361439 AAGAAACCAGGTTCAGAAACTGG - Intronic
1126792712 15:52235578-52235600 GAGACCCCTGGTTCTAAAACTGG + Intronic
1127161780 15:56195607-56195629 AAGACCCGTGTTTCTCAACCAGG + Intronic
1127237953 15:57076196-57076218 AAGATCATAGTTTCTCAAACTGG + Intronic
1127287473 15:57544195-57544217 AAGACTCCCGGATGTCAAACGGG - Intronic
1131697833 15:94898988-94899010 AAGACCAGTGGTTCTCAAACAGG + Intergenic
1131972460 15:97906136-97906158 AAGACCCCAAGTGCTTGAACAGG - Intergenic
1133805455 16:9123288-9123310 GAGAGCCCAGGTTTTCAAGCTGG - Intergenic
1134467259 16:14490489-14490511 AACACACCAGGTTATCACACAGG - Intronic
1135230847 16:20706492-20706514 AAATCCCCAGGTTCTCACAAAGG - Intronic
1135946845 16:26872823-26872845 AAGAGCCCGGGTTCCTAAACAGG - Intergenic
1137252144 16:46748241-46748263 CAGACCCCTGGTTCTCACTCAGG + Exonic
1137805647 16:51302876-51302898 TACACCTCTGGTTCTCAAACTGG - Intergenic
1138348298 16:56333136-56333158 CAGACCCCACGCTCTTAAACTGG - Intronic
1139535730 16:67572443-67572465 TAGATCCCTGTTTCTCAAACTGG + Intronic
1140766488 16:78164073-78164095 ATTACCCCAAGTTCTCAACCAGG - Intronic
1144672525 17:17141001-17141023 AAGACCACAGGCTCGCACACTGG - Intronic
1146425010 17:32729740-32729762 AAGACCCCAGGTTCTAACTTTGG - Intronic
1146518775 17:33510135-33510157 AAGAACTCAGGTTCTGAGACAGG - Intronic
1149374864 17:56033783-56033805 AAGAACCCAAGTTCACAAAAAGG + Intergenic
1149582041 17:57757468-57757490 AAGAATCCAGTTTGTCAAACTGG + Intergenic
1150501179 17:65652239-65652261 AAGAGCCCAGATACTGAAACTGG + Intronic
1151000199 17:70367035-70367057 AAGAGCCCAGGTTCTTACCCCGG + Intergenic
1151161422 17:72168914-72168936 AAGAGCCCAGGTTCCCAGTCTGG + Intergenic
1153075937 18:1161651-1161673 AAGAACCAAGTTACTCAAACTGG - Intergenic
1154391615 18:13941429-13941451 AAGCCCCCAGCTTCTCATCCAGG + Intergenic
1154452473 18:14488876-14488898 AAGACGCCAGCTTCGCAAGCCGG - Intergenic
1158857021 18:61553186-61553208 AAGACCCCAGTTTATCCAAGGGG - Intronic
1160915438 19:1494287-1494309 AAGACAGGAGGTTCTCAAAGGGG + Intronic
1161381239 19:3966197-3966219 CAGAGCCCAGGTGCTCTAACAGG + Intronic
1161474567 19:4477095-4477117 AAGACCCCAGGTTCTCAAACAGG - Intronic
1162869254 19:13573174-13573196 TAGACCACCGATTCTCAAACTGG + Intronic
1163906541 19:20153559-20153581 TAGTCACCAAGTTCTCAAACAGG + Intergenic
1164376246 19:27690763-27690785 CAGACCCCAGGTTTTCTAATGGG - Intergenic
1164876474 19:31694110-31694132 AAGACCCCAGGTCCTGCTACTGG + Intergenic
1165779685 19:38425279-38425301 TAGACCAGTGGTTCTCAAACTGG - Intronic
1166053888 19:40277369-40277391 TAGAGCCCAGCTTCTCAAACTGG - Intronic
1167561364 19:50227802-50227824 AAGTCCCCAGAGTCTCAAAGTGG - Intronic
928100573 2:28435166-28435188 AAGAGCCCATGATCTGAAACAGG - Intergenic
928691401 2:33803240-33803262 ATTCCCCTAGGTTCTCAAACAGG - Intergenic
930067273 2:47337275-47337297 AAGAACCCATGATCTCAGACTGG + Intergenic
930716163 2:54595939-54595961 TAGACCCAAGGTTCTCCAGCAGG - Intronic
931176119 2:59856874-59856896 TAGACCCGTGGTTCTCAACCAGG + Intergenic
931364229 2:61604975-61604997 ATGACCTCAGGTTCTCCAAGAGG - Intergenic
931485234 2:62684007-62684029 AAGATCCCATGTTCTCAGAGTGG + Intronic
932168138 2:69527148-69527170 AACACCCCAGGAGCTCAAAATGG + Intronic
932793540 2:74675685-74675707 CAGACCTCAGGGTCACAAACTGG - Intronic
932865361 2:75335769-75335791 AGCTCCCCAGGTTCTCAAATTGG + Intergenic
933808471 2:86017249-86017271 TAGGGCCGAGGTTCTCAAACTGG + Intergenic
933865124 2:86509173-86509195 AAGATCCCAGATTCTGAAAAAGG + Intronic
934915176 2:98295659-98295681 CAGAACCGAGGTCCTCAAACGGG + Intronic
935296085 2:101650918-101650940 AAGACCCCAGGTTCACTCTCTGG + Intergenic
937331352 2:121032257-121032279 AAGACCCCCGGTTCTCTCACAGG - Intergenic
938683283 2:133713366-133713388 AACAGCCCAGGTATTCAAACAGG + Intergenic
941129016 2:161624035-161624057 AAGCCCCCAGGTACTCAGAGCGG + Intronic
942551497 2:177124438-177124460 AAAAAGCCAGGTTCTCAATCTGG + Intergenic
944636768 2:201682365-201682387 TAGACCAGTGGTTCTCAAACTGG - Intronic
1169949521 20:11027777-11027799 AAGACCCCAGGGCCTCCCACAGG - Exonic
1170446667 20:16435222-16435244 AAGAAGCAACGTTCTCAAACCGG - Intronic
1172975499 20:38902966-38902988 GAGAGGCCAGGTTCTCAAAGAGG - Intronic
1173877817 20:46386542-46386564 TATACCCCACTTTCTCAAACTGG - Intronic
1173974114 20:47174237-47174259 TAGAGTCCCGGTTCTCAAACTGG + Intronic
1177294377 21:19155802-19155824 AAGAGCCCAGATTATCAAAGCGG - Intergenic
1178762238 21:35414178-35414200 GAACCCTCAGGTTCTCAAACAGG + Intronic
1180690939 22:17715060-17715082 AAGACCCCAGGTCCAAGAACTGG + Intronic
1182781565 22:32872730-32872752 AGCACCCCAGGTTCTCCATCTGG + Intronic
1184187299 22:42873392-42873414 AAAAACCCAACTTCTCAAACTGG + Intronic
1184465583 22:44667571-44667593 CAGACCCCAGGTACTCTAATGGG - Intergenic
1184732384 22:46377964-46377986 TAGACCCCAGGGTCCCACACAGG + Intronic
949535649 3:4994547-4994569 AAGAGCCCAGGATGTCAAAATGG + Intergenic
950035723 3:9883900-9883922 TAGACCACTGGTTCTCAAAGTGG - Intergenic
950898115 3:16472199-16472221 AAGTCCCAAGTTTCACAAACAGG - Intronic
954659912 3:52221540-52221562 AGGCCCACAGGTTCTCAAAGAGG + Exonic
955001512 3:54931613-54931635 AGGACCCCAGGTTCCCACATGGG + Intronic
962158399 3:132973589-132973611 AAGACACCATGTTCTCAACTGGG - Intergenic
963006392 3:140729758-140729780 AAGACTCAAGGTTCTTAAGCAGG + Intergenic
963102644 3:141621657-141621679 ATGACCCCAGGTTCTCCATTTGG + Intergenic
963328272 3:143886081-143886103 TAGACCAGTGGTTCTCAAACAGG - Intergenic
964624196 3:158743520-158743542 AATACACCATCTTCTCAAACAGG - Intronic
970449120 4:16149544-16149566 AAGACCTCAGCTTTTCAAATGGG + Intergenic
971123501 4:23727307-23727329 ATGACCTCAGGTCCTCAGACCGG - Intergenic
972801925 4:42485347-42485369 AAGACTTGAGGTTCACAAACTGG - Intronic
978358604 4:107904458-107904480 AATACCCCAGGTAATCAAAGGGG - Intronic
982742113 4:159068421-159068443 AACACCCCATGTTCTCACTCAGG + Intergenic
983901263 4:173137143-173137165 TAGACTACAGCTTCTCAAACTGG + Intergenic
984551799 4:181169649-181169671 AAGACTCCATTCTCTCAAACAGG + Intergenic
984896342 4:184544364-184544386 AAAAGCCAAAGTTCTCAAACAGG + Intergenic
986362523 5:6994174-6994196 AACACCCCAGGCTCTCAAATGGG - Intergenic
990146312 5:52764641-52764663 AAGACCACTGGTTTTCAGACTGG - Intergenic
995585641 5:113645315-113645337 AAAACACAAGGCTCTCAAACAGG - Intergenic
997064463 5:130545310-130545332 AAGACCCCAGTTTACCAAAGAGG - Intergenic
999013173 5:148065840-148065862 ATAACCCCAGCATCTCAAACAGG - Intronic
1000005727 5:157182590-157182612 AATCCCCCAAGTTCACAAACTGG - Intronic
1002207572 5:177574158-177574180 AAGAAGCCAGGTCCTCAAAAAGG - Intergenic
1003640507 6:7871558-7871580 AAGGCCCCAGGTGCTCATCCAGG - Intronic
1003906101 6:10701025-10701047 AACACCACATGTTCTCACACAGG - Intronic
1004119239 6:12803890-12803912 TAGAGCACAGGTTCTCAAATGGG - Intronic
1005616972 6:27582854-27582876 AACACGCCAGGATCTCTAACTGG - Intergenic
1007606483 6:43121507-43121529 AAGGTCCCAGGTTCACCAACAGG - Intronic
1009342102 6:62568742-62568764 AAGACCACAGGTTTGCAGACTGG + Intergenic
1012292851 6:97480707-97480729 AAGCCCCCAGGATCTCTAGCTGG - Intergenic
1013175481 6:107673240-107673262 AAGAGGTCAGGTCCTCAAACAGG - Intergenic
1013270986 6:108545223-108545245 AGGACCCCAGAACCTCAAACAGG + Intergenic
1015858638 6:137652547-137652569 GAGTCCCCAGGTTATCACACTGG - Intergenic
1017952956 6:159152380-159152402 AAGAACTCAGATTCTCTAACTGG + Intergenic
1019094547 6:169568106-169568128 GAGACCAGTGGTTCTCAAACAGG + Intronic
1021906021 7:25334207-25334229 AAGATACCAGTTTCTAAAACAGG - Intergenic
1022717983 7:32915882-32915904 TAGAGCCCAGGTTCTCCAAGTGG + Intergenic
1025249896 7:57344599-57344621 AGGTCCCCAGGTTCTGGAACTGG - Intergenic
1029932298 7:104385070-104385092 ACCACACCAGGTTCTCAAATGGG - Intronic
1030334739 7:108313132-108313154 AAGGCCCCAGGTTTTCAACAAGG + Intronic
1034134929 7:148758165-148758187 TAGAACACTGGTTCTCAAACTGG - Intronic
1034548841 7:151807614-151807636 AAAAGCCCAGTTTCTCCAACAGG + Intronic
1038705307 8:29887974-29887996 ACTACTCCAGGTTCTCAAAGTGG + Intergenic
1041388644 8:57329986-57330008 AAGACCCCAGGAATTCAACCAGG + Intergenic
1041553372 8:59125212-59125234 AATACCCCAGATTCCCAATCAGG + Intergenic
1042064835 8:64863234-64863256 AAGACCAGGGGTTCTTAAACAGG + Intergenic
1045029248 8:98119371-98119393 TAGTTCCCAGGTTCTCAAACTGG + Intronic
1058285445 9:103171176-103171198 AGGAAGCCAAGTTCTCAAACTGG + Intergenic
1058888982 9:109344756-109344778 AAGACCAGTGGTTCTCAATCTGG + Intergenic
1186659870 X:11659003-11659025 AAGACCAGTGGTTCTCAACCAGG - Intronic
1188138071 X:26514445-26514467 TAGACTCCAGGTTCCCACACAGG - Intergenic
1188771764 X:34162289-34162311 AAGACCAAAGGTTTCCAAACAGG - Intergenic
1191661640 X:63657643-63657665 AGGAACCCAGGTTCTGAAATAGG - Intronic
1191939632 X:66464059-66464081 AAGAACCCAGGCTGTCACACTGG - Intergenic
1193495633 X:82207847-82207869 AGGACTCCAGGTTTTCAAAGCGG - Intergenic
1194738163 X:97539318-97539340 AAGGCCCAAGGTTCTCTAAAGGG + Intronic
1196018146 X:110961202-110961224 TAGTCCACAGGTTCTCAATCTGG - Intronic
1196089556 X:111725343-111725365 AAGAACCATGGTTCTCAACCAGG - Intronic
1197131933 X:123015255-123015277 AAAACCAGGGGTTCTCAAACCGG - Intergenic
1197141595 X:123122761-123122783 AAAACCCCAGGTCATCAAATAGG + Intergenic
1199995384 X:153021520-153021542 GAGACCCCAAGTTCTCAAAGAGG - Intergenic