ID: 1161474567

View in Genome Browser
Species Human (GRCh38)
Location 19:4477095-4477117
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161474567_1161474573 16 Left 1161474567 19:4477095-4477117 CCTGTTTGAGAACCTGGGGTCTT No data
Right 1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG No data
1161474567_1161474572 11 Left 1161474567 19:4477095-4477117 CCTGTTTGAGAACCTGGGGTCTT No data
Right 1161474572 19:4477129-4477151 TCTGTGCCTCTCCTTTGTTTCGG No data
1161474567_1161474575 17 Left 1161474567 19:4477095-4477117 CCTGTTTGAGAACCTGGGGTCTT No data
Right 1161474575 19:4477135-4477157 CCTCTCCTTTGTTTCGGCCTGGG No data
1161474567_1161474578 22 Left 1161474567 19:4477095-4477117 CCTGTTTGAGAACCTGGGGTCTT No data
Right 1161474578 19:4477140-4477162 CCTTTGTTTCGGCCTGGGCTGGG No data
1161474567_1161474579 25 Left 1161474567 19:4477095-4477117 CCTGTTTGAGAACCTGGGGTCTT No data
Right 1161474579 19:4477143-4477165 TTGTTTCGGCCTGGGCTGGGTGG No data
1161474567_1161474576 21 Left 1161474567 19:4477095-4477117 CCTGTTTGAGAACCTGGGGTCTT No data
Right 1161474576 19:4477139-4477161 TCCTTTGTTTCGGCCTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161474567 Original CRISPR AAGACCCCAGGTTCTCAAAC AGG (reversed) Intronic