ID: 1161474570

View in Genome Browser
Species Human (GRCh38)
Location 19:4477107-4477129
Sequence ACAGGCCACCTCAAGACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 151}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161474570_1161474575 5 Left 1161474570 19:4477107-4477129 CCTGGGGTCTTGAGGTGGCCTGT 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1161474575 19:4477135-4477157 CCTCTCCTTTGTTTCGGCCTGGG 0: 1
1: 0
2: 1
3: 10
4: 117
1161474570_1161474576 9 Left 1161474570 19:4477107-4477129 CCTGGGGTCTTGAGGTGGCCTGT 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1161474576 19:4477139-4477161 TCCTTTGTTTCGGCCTGGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 98
1161474570_1161474572 -1 Left 1161474570 19:4477107-4477129 CCTGGGGTCTTGAGGTGGCCTGT 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1161474572 19:4477129-4477151 TCTGTGCCTCTCCTTTGTTTCGG 0: 1
1: 1
2: 2
3: 32
4: 378
1161474570_1161474579 13 Left 1161474570 19:4477107-4477129 CCTGGGGTCTTGAGGTGGCCTGT 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1161474579 19:4477143-4477165 TTGTTTCGGCCTGGGCTGGGTGG 0: 1
1: 0
2: 0
3: 15
4: 215
1161474570_1161474573 4 Left 1161474570 19:4477107-4477129 CCTGGGGTCTTGAGGTGGCCTGT 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 67
1161474570_1161474578 10 Left 1161474570 19:4477107-4477129 CCTGGGGTCTTGAGGTGGCCTGT 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1161474578 19:4477140-4477162 CCTTTGTTTCGGCCTGGGCTGGG 0: 1
1: 0
2: 1
3: 8
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161474570 Original CRISPR ACAGGCCACCTCAAGACCCC AGG (reversed) Intronic
900496453 1:2978155-2978177 ACAAGCCTGCTCAAGGCCCCTGG - Intergenic
900655075 1:3752825-3752847 ACAGGTCACCTCAAGGCTCGTGG - Intronic
901090037 1:6634931-6634953 ACAGGCCAGCTCAAGCCCGCTGG + Exonic
901916725 1:12505875-12505897 GCAGGCCACCTCCTGCCCCCAGG + Intronic
902372998 1:16017171-16017193 GCAGGCAACATCAAGACCCTAGG - Exonic
903459114 1:23508566-23508588 AAAGACCCCCTCAGGACCCCAGG + Exonic
904747383 1:32719615-32719637 ACAGGCCTCCTGGAGAGCCCTGG - Intergenic
908119129 1:60969114-60969136 GCAGGCCTCCTCCAGACCCATGG + Intronic
913937207 1:125065778-125065800 ACAGCCCCCCCCAAGCCCCCGGG - Intergenic
918373629 1:183886195-183886217 ACAGACCACCTGAAGACTCAAGG - Intronic
918757401 1:188355954-188355976 CCAGGCCACCTCAATGCCCTGGG + Intergenic
919777669 1:201204930-201204952 ACAGGTCACCTCTGGACCTCAGG - Intronic
920294424 1:204947134-204947156 ACAGGGGTCCTCAAGACCCATGG + Intronic
920380066 1:205530078-205530100 TCAGGCCATCTCAAGACTCAGGG - Intronic
920693968 1:208167626-208167648 GAAGGCCATCTCAGGACCCCTGG + Intronic
924626608 1:245700892-245700914 CCTGGCCACTTCAAGATCCCAGG + Intronic
1064158219 10:12921379-12921401 ACAGGCCAGCTCTGGGCCCCGGG - Intronic
1065824723 10:29560087-29560109 ACACGACAGCTCAAGAGCCCAGG + Intronic
1069517576 10:69090860-69090882 ACAGGCCTCATCAAATCCCCTGG - Intronic
1069699191 10:70408639-70408661 TCTGGCCACCTCCAGACTCCTGG + Intronic
1069821842 10:71233297-71233319 TGGGGCCACCTCAGGACCCCGGG - Intronic
1070519050 10:77235935-77235957 TCTGGCCAGCCCAAGACCCCTGG - Intronic
1070917134 10:80162058-80162080 ACAGGCCACACCCAGACCCCAGG + Intronic
1076686363 10:132200082-132200104 ACACCCCACCCCAGGACCCCGGG - Intronic
1077184140 11:1228902-1228924 AGAGGCCACCCCAGGACCCCAGG + Intronic
1077440725 11:2567472-2567494 CAAGGCCACAGCAAGACCCCAGG - Intronic
1077995309 11:7447408-7447430 ACAGGCCACTTCTAGTACCCTGG + Intronic
1079017587 11:16882376-16882398 ACAAGCCTCCTCCAGGCCCCAGG + Intronic
1080588939 11:33704709-33704731 ACAGGCCAGCTCTAGAGGCCAGG + Intronic
1081914175 11:46720187-46720209 GGAGGCCACCACAAGCCCCCGGG + Intronic
1083271946 11:61577139-61577161 ACAGGCCCCCTCCAGGGCCCTGG - Intronic
1084342265 11:68513166-68513188 ACAGGCAAGCTGAAGACCCCCGG - Intronic
1085529166 11:77181532-77181554 GCAGGCCACCTGAAGTCCCCAGG - Exonic
1088854133 11:113731438-113731460 ACAGGTACCCTCAAGATCCCAGG + Intergenic
1090175033 11:124641024-124641046 ACAAACTACCTCAAAACCCCCGG - Intronic
1091919921 12:4295952-4295974 ACATGTCACCTCAAGTCCCGTGG + Intronic
1092041945 12:5393057-5393079 AGGAGGCACCTCAAGACCCCTGG - Intergenic
1093912973 12:24768301-24768323 CCAGGCCTACTCAACACCCCAGG + Intergenic
1094450523 12:30578706-30578728 ACAGGCCCCTCCAAGAACCCTGG + Intergenic
1103882476 12:124176645-124176667 AGAGGCCACCTCATGAGTCCTGG - Intronic
1104630746 12:130400009-130400031 ACAGGAGAAATCAAGACCCCAGG - Intronic
1104670914 12:130679545-130679567 ACAGGACACCTCAGGACCTTGGG - Intronic
1104873949 12:132019972-132019994 ACAGGCCACCTCATGGAGCCGGG - Intronic
1108069514 13:46613834-46613856 TCAGGCCACTTCAAAAGCCCTGG - Intronic
1108325527 13:49326956-49326978 ATAGGCCCTCTCAAGACCCTTGG - Intronic
1112319938 13:98396414-98396436 GCAGGCCACCCAAGGACCCCCGG - Intronic
1118549943 14:66939557-66939579 ACACGCAAGCTGAAGACCCCAGG + Intronic
1119980929 14:79080200-79080222 ACTGGCCACTTTAAGGCCCCTGG + Intronic
1126501652 15:49352723-49352745 ACAGCGCACTTCAAGACCCTTGG + Intronic
1128510556 15:68311517-68311539 AAAGGCCCACTCAAGACCCCTGG + Intronic
1128529131 15:68432034-68432056 CCAGGCCACCACCAGGCCCCTGG + Exonic
1131167865 15:90155644-90155666 ACAGGCCACACCAACACTCCTGG + Intergenic
1132574583 16:658632-658654 ACAGGCCAGCCCAGGCCCCCAGG + Exonic
1132726588 16:1341530-1341552 ACAGCCCAGCTCTGGACCCCAGG - Intronic
1132883213 16:2171392-2171414 AGAGGCCCCCACAGGACCCCAGG + Intronic
1133270693 16:4609662-4609684 ACAGGCCACCTCAGAACCCAGGG - Exonic
1133344336 16:5060028-5060050 ACACACCACCTCCAGGCCCCAGG - Intronic
1133931650 16:10237629-10237651 ACAGGGCACTGCAAGACTCCAGG + Intergenic
1135915902 16:26605277-26605299 AAAAGCCATCTCTAGACCCCTGG + Intergenic
1138385920 16:56635624-56635646 ACAGGCCAGCCCAGGACCGCTGG + Intergenic
1140098937 16:71897801-71897823 ACAGGCCACACCAACACTCCTGG - Intronic
1141753326 16:85974437-85974459 TGACGCCACCTCAGGACCCCAGG - Intergenic
1143299550 17:5899554-5899576 TCAGGCTCCCTCAAGATCCCCGG - Intronic
1145250431 17:21294171-21294193 CCAGGCCACCTCTATTCCCCAGG - Intronic
1147881400 17:43656405-43656427 ACAGGCCACCTCCCCGCCCCAGG - Intronic
1152014706 17:77742773-77742795 ACTGGCTGCCCCAAGACCCCAGG + Intergenic
1152695456 17:81741677-81741699 GCAAGCCACCTCCAGAGCCCTGG + Intergenic
1152935910 17:83136555-83136577 ACAGGCCCCATCAAGATCCCTGG + Intergenic
1155610208 18:27658708-27658730 TCAGGCCAAGTCAAGACCCTGGG + Intergenic
1157096239 18:44687843-44687865 AGAGGACACCTCAGGAACCCAGG - Intronic
1157471758 18:47994248-47994270 ACAGGCCACTCCTAGGCCCCAGG - Intergenic
1157591955 18:48841522-48841544 ACAGGCCAGCTCAGAACGCCGGG - Intronic
1161474570 19:4477107-4477129 ACAGGCCACCTCAAGACCCCAGG - Intronic
1162572560 19:11481487-11481509 GTAGACCACCTCAAGACCACGGG + Intronic
1163150435 19:15409812-15409834 CCAGGCCACCTCAAGCCAGCAGG - Intronic
1165093329 19:33397644-33397666 ACAGGGATCCTCCAGACCCCAGG + Intronic
1166978808 19:46620874-46620896 ACTGCCCACCCCAAGTCCCCAGG - Exonic
1167452504 19:49580433-49580455 CCAGTCTCCCTCAAGACCCCAGG + Intronic
1168717675 19:58538817-58538839 ACCGGAGACCTCACGACCCCAGG + Intronic
927939980 2:27097470-27097492 ACAGGGCAGCTCAGGACCGCTGG - Intronic
928438672 2:31273269-31273291 ACAGGTCATCTCCAGGCCCCTGG - Intergenic
935053615 2:99545586-99545608 TCAGGCTACATCAATACCCCTGG + Intronic
935333416 2:101994178-101994200 CCAGGCCAACTGAAGACCCCGGG - Intronic
936053705 2:109244753-109244775 ACAGGCTGCCTCAAGGGCCCGGG - Intronic
936399400 2:112154344-112154366 ACGGGGCGCCTCAAGAGCCCTGG + Intronic
937302409 2:120851416-120851438 AGGGGCCACCTCCAGTCCCCTGG - Intronic
938230637 2:129655703-129655725 ACCGGCCAGCCCAAGACCACAGG - Intergenic
941417350 2:165237584-165237606 GCACGCCACCTCATGCCCCCAGG - Intergenic
948853874 2:240721179-240721201 GTTGGCCAGCTCAAGACCCCCGG + Intronic
948895957 2:240926940-240926962 ACAGGTCACCTGAGGATCCCGGG + Intronic
948992915 2:241563822-241563844 CGAGGCCATCTGAAGACCCCTGG - Intronic
1170368054 20:15618685-15618707 CCAAGCCACCTCCTGACCCCTGG + Intronic
1171122010 20:22576562-22576584 CAGGGCCACCTCCAGACCCCCGG + Intergenic
1171422093 20:25024333-25024355 ACAGTGGGCCTCAAGACCCCAGG + Intronic
1172186711 20:33035517-33035539 ACGGGCCATCCCAAGAGCCCTGG - Intronic
1173673961 20:44817723-44817745 ACAGGCCAAAGCCAGACCCCCGG + Intergenic
1174445165 20:50586036-50586058 ACAGCGCACCACAAGACCACAGG + Intergenic
1175891711 20:62318688-62318710 CCAGGCCCCTTCATGACCCCTGG + Intronic
1177071597 21:16515711-16515733 AGAGGCCACCAAAAGACTCCTGG - Intergenic
1179655155 21:42840016-42840038 CCGGGCCGCCTCAAGCCCCCAGG + Intergenic
1179655181 21:42840075-42840097 CCGGGCCGCCTCAAGCCCCCAGG + Intergenic
1179840118 21:44067114-44067136 TCAGGACTCCTCCAGACCCCAGG + Intronic
1179947451 21:44687738-44687760 CCAGGCCCCCTCAAGGCCCAGGG - Intronic
1180929469 22:19579167-19579189 ACAGGGCCCCTTGAGACCCCAGG - Intergenic
1181674723 22:24444271-24444293 ACAGGCCTCCTCATGTCCTCAGG + Intergenic
1182072394 22:27472933-27472955 ACAGGCCTCGTCAAGAAGCCTGG + Intergenic
1182104760 22:27681537-27681559 GCAGGCCAGGTCAAGCCCCCAGG - Intergenic
1183608922 22:38884150-38884172 AGGGGCCCCCTCAAGACCCCAGG - Intergenic
1184043988 22:41960808-41960830 ACTGGCCACCTTAAGGCCTCCGG - Intergenic
1185240002 22:49737290-49737312 ACAGGACCCTTGAAGACCCCAGG + Intergenic
952114169 3:30159464-30159486 ACAGGCCACAACAAGGCCGCTGG - Intergenic
953438176 3:42896478-42896500 ACAGGCCAGCCCAAGGCCACAGG + Intronic
954121249 3:48501425-48501447 ACAGGCCACCTTCTGACCCCTGG + Intronic
956876765 3:73471514-73471536 ACAAGCCACCTCAAAACACTTGG - Intronic
961017874 3:123481526-123481548 CCAGGGCTTCTCAAGACCCCAGG + Intergenic
961451823 3:127005671-127005693 GCAGCCCCCCGCAAGACCCCAGG - Intronic
963798315 3:149653540-149653562 ACAGGACACCTGAACACCACAGG + Intronic
967416490 3:189224336-189224358 ACAGGCCACGTCACCACGCCTGG - Intronic
967791978 3:193559735-193559757 ACAGGCCACCCCAAGGCACTGGG - Intronic
968520162 4:1031514-1031536 AGAGGCCACCTTTTGACCCCAGG - Intergenic
970535607 4:17027173-17027195 ACAAGCCACCTGAAGACCTCAGG + Intergenic
971250572 4:24970398-24970420 AAAGGACACCTCAAGACCCAAGG + Intronic
976264050 4:83173559-83173581 AGAGCCCAGCGCAAGACCCCAGG - Intergenic
978843357 4:113242265-113242287 AGAAGGCACCTCAAGACACCAGG + Intronic
986670846 5:10141078-10141100 CCAGGCCACCTCAAGCCCCCAGG + Intergenic
996070597 5:119126786-119126808 ACAGAACTCTTCAAGACCCCTGG - Intronic
997781955 5:136667823-136667845 AGACCCCACCTCAAGCCCCCAGG - Intergenic
998813099 5:145986174-145986196 AGGGGCCACCTCCAGCCCCCAGG + Intronic
1001498332 5:172206834-172206856 ACAGGCCACCTGAACACACTTGG - Intergenic
1005819177 6:29582990-29583012 ACAGGTCTCCTCAAGATCCATGG + Intronic
1006135393 6:31892784-31892806 ACAGACCACATCAAGCCACCGGG + Intronic
1006718178 6:36133257-36133279 ACAGGCAGCCTCAAGACCTGGGG + Intronic
1008474833 6:51925073-51925095 GCAGTCCACTTCAAGAGCCCAGG + Intronic
1011023146 6:82836505-82836527 ACATGCCACTTCCAGACCACTGG + Intergenic
1014295734 6:119614712-119614734 ACTAGGGACCTCAAGACCCCAGG - Intergenic
1017043650 6:150327470-150327492 ACAAGCCACGTCAGGACCTCAGG - Intergenic
1017537561 6:155364386-155364408 ACACGCCACCTTAAGACACATGG + Intergenic
1019190945 6:170250277-170250299 CCTGGACACCTCAAGACTCCAGG + Intergenic
1020070454 7:5223717-5223739 ACTGGGCACCTCAAGCCACCAGG + Intronic
1020278021 7:6636667-6636689 ACAGGCGACCCCAGGAACCCAGG - Intergenic
1021923019 7:25505970-25505992 GCATGCCCCCTCAAGTCCCCGGG - Intergenic
1023312511 7:38902421-38902443 GCAGGCCATATCCAGACCCCAGG - Intronic
1024089231 7:45921543-45921565 CCAGGCCACCTCAGCACCCCCGG + Intronic
1024452528 7:49563979-49564001 ACAGGCCATCTCAGGGCCCCAGG + Intergenic
1025927969 7:65974343-65974365 ACAGACCACATCACGACCGCGGG + Exonic
1029488505 7:100857532-100857554 TCAGGCCACCTCCAGCTCCCCGG - Intronic
1029637672 7:101795749-101795771 TTAGGCCACCTCAAGTCCTCTGG - Intergenic
1033307028 7:140232250-140232272 TCAGGCCAACTCGAGACCCGTGG + Intergenic
1034532771 7:151707085-151707107 ACAGGGGACCACAAGTCCCCAGG + Intronic
1035201731 7:157272053-157272075 ACAGGCCACGTCCTGACTCCAGG - Intergenic
1035697943 8:1614445-1614467 AGAGGCCACCTCCAGTCCGCCGG - Intronic
1036807818 8:11847400-11847422 CCAGGATACCTCAAGACTCCAGG + Intronic
1037766815 8:21777315-21777337 ACAGGCCCCCACACCACCCCGGG - Intronic
1038916591 8:32031242-32031264 CCAGGCCACCCCAGGACCTCAGG + Intronic
1043477222 8:80616923-80616945 ACAGGCCACCTAAATACCCGAGG - Intergenic
1044828534 8:96222097-96222119 ACAGCCCACCTAAAGAACCAGGG + Intergenic
1044923246 8:97187670-97187692 ACAGCCCACTTCAAGACCCAAGG + Intergenic
1049021381 8:139959806-139959828 AGAGGCTAACTCAAGACCCCAGG + Intronic
1049159471 8:141087999-141088021 AGAGCCCACCTCAAGTGCCCGGG + Intergenic
1050115481 9:2259054-2259076 ACAAGGCACCTCATGAGCCCAGG + Intergenic
1051408268 9:16762451-16762473 ACAATCCACTTCAAAACCCCTGG + Intronic
1054880076 9:70135484-70135506 TCAGACCTCCTCAAGACCCCAGG + Intronic
1056659753 9:88535141-88535163 CCAGGCAACCTCAAGCCCTCAGG - Exonic
1057025631 9:91732427-91732449 ACAGGCCACACCCAGGCCCCGGG + Intronic
1203771236 EBV:51073-51095 ACAGCCCCCCTCAAGTCCCTGGG - Intergenic
1186449709 X:9661894-9661916 TCAGGCCCCCACAAGACACCTGG - Intronic
1187363600 X:18649493-18649515 ACAGGCCAGCTTCAGACCTCTGG + Intronic
1187383899 X:18830196-18830218 ACAGTCCACATAAAGACCACTGG - Intergenic
1187631368 X:21176355-21176377 ACAAGCCACTTTAAGACCACAGG - Intergenic
1187981174 X:24759094-24759116 AAAGGCCAACTCACAACCCCAGG - Intronic
1192464976 X:71348321-71348343 CCAGCCCAACTCAAGACGCCCGG + Intergenic
1195020407 X:100820923-100820945 ACAAGCCATCTCAGGACACCAGG - Intronic