ID: 1161474571

View in Genome Browser
Species Human (GRCh38)
Location 19:4477125-4477147
Sequence AACAAAGGAGAGGCACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161474571_1161474581 18 Left 1161474571 19:4477125-4477147 CCTGTCTGTGCCTCTCCTTTGTT No data
Right 1161474581 19:4477166-4477188 TGCTTGTGAGCATTTGCTCCAGG No data
1161474571_1161474576 -9 Left 1161474571 19:4477125-4477147 CCTGTCTGTGCCTCTCCTTTGTT No data
Right 1161474576 19:4477139-4477161 TCCTTTGTTTCGGCCTGGGCTGG No data
1161474571_1161474579 -5 Left 1161474571 19:4477125-4477147 CCTGTCTGTGCCTCTCCTTTGTT No data
Right 1161474579 19:4477143-4477165 TTGTTTCGGCCTGGGCTGGGTGG No data
1161474571_1161474578 -8 Left 1161474571 19:4477125-4477147 CCTGTCTGTGCCTCTCCTTTGTT No data
Right 1161474578 19:4477140-4477162 CCTTTGTTTCGGCCTGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161474571 Original CRISPR AACAAAGGAGAGGCACAGAC AGG (reversed) Intronic