ID: 1161474573

View in Genome Browser
Species Human (GRCh38)
Location 19:4477134-4477156
Sequence GCCTCTCCTTTGTTTCGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161474567_1161474573 16 Left 1161474567 19:4477095-4477117 CCTGTTTGAGAACCTGGGGTCTT 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 67
1161474570_1161474573 4 Left 1161474570 19:4477107-4477129 CCTGGGGTCTTGAGGTGGCCTGT 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 67
1161474563_1161474573 22 Left 1161474563 19:4477089-4477111 CCTGGTCCTGTTTGAGAACCTGG 0: 1
1: 0
2: 0
3: 16
4: 200
Right 1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161474573 Original CRISPR GCCTCTCCTTTGTTTCGGCC TGG Intronic
914444715 1:147740185-147740207 GTCTCTCCTTTCTGTGGGCCTGG - Intergenic
915312589 1:155011828-155011850 GCCTCCCCCTTCTTTCTGCCAGG - Intronic
915621667 1:157089928-157089950 GACTCTGCTGTGTCTCGGCCCGG + Intergenic
919866415 1:201786444-201786466 GCCTCTCCTTGGTCTCCTCCTGG - Exonic
922958999 1:229628985-229629007 GCCTCCCCTTTGTTTCACCCTGG - Intronic
924624806 1:245688998-245689020 GCCTCTCCTTTCCCACGGCCCGG + Intronic
1065844703 10:29735497-29735519 GCCGCGCCTTTGTTACGGCTCGG + Intronic
1065875440 10:29993617-29993639 TTCTCTCCTTTGTTTCATCCTGG - Intergenic
1066441094 10:35439807-35439829 GCCACTCCCTTGTTACTGCCAGG + Intronic
1067348659 10:45456303-45456325 GCCTCTCCTTTCTGTCTCCCAGG - Exonic
1072853803 10:98925405-98925427 GGCACTGCTTTGTTTCTGCCAGG + Intronic
1076112720 10:127873213-127873235 GCCTCTCCTTGGTTGTGGCATGG + Intergenic
1077037507 11:502531-502553 GCCTCTCATTTGCTTGGGCAAGG + Exonic
1078758884 11:14235858-14235880 CTCTCTCCTTTGTTTCCTCCAGG - Intronic
1080418586 11:32091424-32091446 GCCTCTCCTTGCTCTCGTCCGGG - Exonic
1083154221 11:60812705-60812727 CCCTCTCCTTTTTTTCAGCCAGG - Intergenic
1084102289 11:66957793-66957815 TCCTCTACTTTGTTTCAGACGGG - Intronic
1084537287 11:69764601-69764623 GCCTGTCCTTTCTTCCGTCCAGG - Intergenic
1084950126 11:72660325-72660347 GCCCCTCCTTAGTTTCTGCATGG - Intronic
1096789282 12:54034900-54034922 CCCTCTCCTTTGTTCCCGGCTGG + Exonic
1105860263 13:24403899-24403921 GCCTCTCCTTTGTGGCATCCCGG + Intergenic
1107529175 13:41265664-41265686 ACCTCTTCTTTGTTTGGGCAGGG - Intergenic
1107942951 13:45391099-45391121 GCCTCTCCTTGCTCTCGTCCGGG + Intergenic
1108693859 13:52885428-52885450 GCCTCTGCTTAGTTTCAGCAGGG - Intergenic
1109766472 13:66906589-66906611 GCCTCTCCTGTGTTTCATTCTGG + Intronic
1112936712 13:104809596-104809618 GCCTCTCCTTAGCCTCAGCCTGG - Intergenic
1115754711 14:36519550-36519572 GCCTCGCGTTTGTTTTAGCCCGG + Intronic
1117505802 14:56401666-56401688 GGCTCTACTTTGTATAGGCCAGG + Intergenic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1122381562 14:101310556-101310578 GCATCTCCTTTGTCTCTACCAGG + Intergenic
1122975808 14:105170294-105170316 ACCTCTCCTGTGCTTTGGCCTGG + Intergenic
1125297735 15:38221213-38221235 CCCTCTCCTTAGCTTAGGCCTGG - Intergenic
1142627975 17:1204057-1204079 GCCTCTCCCTCATCTCGGCCTGG + Intronic
1143963346 17:10738604-10738626 GCCTTTCCTCTGTGTGGGCCAGG - Intergenic
1150735834 17:67738296-67738318 TGCTCTCCTTTGTTTCGTCCTGG - Exonic
1159754519 18:72348052-72348074 GGCACTCCTGTGTTTCTGCCCGG - Intergenic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1162568555 19:11457600-11457622 GTCTCTGCTCTGTTTGGGCCAGG + Intronic
1164080602 19:21858708-21858730 GCCTCTCCTCTGTTTCTACCAGG - Intergenic
1164747988 19:30629971-30629993 TCCACTCCCTTGTTTCTGCCAGG + Intronic
936013879 2:108943302-108943324 GCCTCCCCTCTGTTTCTCCCAGG - Intronic
943388903 2:187236752-187236774 GCCTCTCCTTTAGGTCAGCCTGG - Intergenic
947496055 2:230638012-230638034 CCCTCTCCTTTTTTTGGGACAGG - Intergenic
1175913516 20:62415443-62415465 GCCCCTCCTTTGTCCCGGGCAGG - Intronic
1177732177 21:25041762-25041784 GCAGCTCCTTTGATTCAGCCTGG - Intergenic
1178615489 21:34129372-34129394 GCCTCTGCTCTGTTTCTACCGGG + Intronic
1179722260 21:43322492-43322514 GCCTCTGCTTGGTTTCTGGCTGG - Intergenic
1181181666 22:21072924-21072946 GGCTCTCCTTTGCTCTGGCCTGG + Intergenic
1182711069 22:32323688-32323710 GCCTCTGCTTGGTTTCCCCCAGG + Intergenic
954109240 3:48424984-48425006 GCCTCTCCTTTCTTGGGGTCTGG - Intronic
958762494 3:98326151-98326173 GTCTCTCTTTTGTTTGAGCCAGG + Intergenic
963326735 3:143871431-143871453 GCCTCTACTTTATTTCAGCAAGG + Intergenic
968288222 3:197520442-197520464 GCCTCCCCTCTGTGTGGGCCGGG + Intronic
973981864 4:56314477-56314499 GCCTCTCCTCCGCTTGGGCCTGG - Exonic
976111285 4:81676669-81676691 GCCTTTCCTTTCTTACAGCCTGG - Intronic
977745575 4:100542759-100542781 TCCTCACCTTTCTTTCTGCCTGG + Intronic
991389799 5:66130200-66130222 TCCTCACTTTGGTTTCGGCCTGG - Intergenic
992572617 5:78075413-78075435 GCCTTTCCTTTGTTTTGGTATGG - Intronic
1000988635 5:167888713-167888735 GCCTTTCCTTTGATTCCCCCAGG + Intronic
1011044219 6:83064522-83064544 TACTCTCCTTTGTTTAGGCAAGG - Intronic
1011714450 6:90089929-90089951 GCCTCACATTTGTTCAGGCCAGG + Intronic
1019017630 6:168891378-168891400 TCCTCTCCTTTGCTTCTGCCTGG + Intergenic
1027730518 7:81866197-81866219 GCCTCTACTTTCTTTAGGTCTGG - Intergenic
1029956636 7:104647237-104647259 GCCTCTCCCTTTTTTCAGACAGG + Intronic
1038481536 8:27905169-27905191 CCCTCTCCTTTGTTTTCCCCTGG - Intronic
1050357708 9:4798684-4798706 GCCTATATTTTATTTCGGCCTGG + Intronic
1057233175 9:93337542-93337564 GCTTCTCCTTTGCTTTTGCCAGG + Intronic
1057275688 9:93674972-93674994 GCCTTTCCTTTTCTTCGACCGGG - Exonic
1057835689 9:98443216-98443238 GCCTCCTCTTTGTTTCTCCCAGG + Intronic
1060832424 9:126724798-126724820 CCCTCTCCTTTGTTTCCGTGTGG + Intergenic
1062305916 9:135907186-135907208 GCGGCGCCTTTGTTGCGGCCGGG - Exonic
1193681034 X:84518969-84518991 CCCTCCCCTGTGTTCCGGCCAGG + Intergenic
1199664619 X:150086948-150086970 CCCTCTCCTTTGTCTCAGCATGG + Intergenic