ID: 1161474575

View in Genome Browser
Species Human (GRCh38)
Location 19:4477135-4477157
Sequence CCTCTCCTTTGTTTCGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161474563_1161474575 23 Left 1161474563 19:4477089-4477111 CCTGGTCCTGTTTGAGAACCTGG No data
Right 1161474575 19:4477135-4477157 CCTCTCCTTTGTTTCGGCCTGGG No data
1161474567_1161474575 17 Left 1161474567 19:4477095-4477117 CCTGTTTGAGAACCTGGGGTCTT No data
Right 1161474575 19:4477135-4477157 CCTCTCCTTTGTTTCGGCCTGGG No data
1161474570_1161474575 5 Left 1161474570 19:4477107-4477129 CCTGGGGTCTTGAGGTGGCCTGT No data
Right 1161474575 19:4477135-4477157 CCTCTCCTTTGTTTCGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161474575 Original CRISPR CCTCTCCTTTGTTTCGGCCT GGG Intronic