ID: 1161474578

View in Genome Browser
Species Human (GRCh38)
Location 19:4477140-4477162
Sequence CCTTTGTTTCGGCCTGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161474567_1161474578 22 Left 1161474567 19:4477095-4477117 CCTGTTTGAGAACCTGGGGTCTT No data
Right 1161474578 19:4477140-4477162 CCTTTGTTTCGGCCTGGGCTGGG No data
1161474571_1161474578 -8 Left 1161474571 19:4477125-4477147 CCTGTCTGTGCCTCTCCTTTGTT No data
Right 1161474578 19:4477140-4477162 CCTTTGTTTCGGCCTGGGCTGGG No data
1161474563_1161474578 28 Left 1161474563 19:4477089-4477111 CCTGGTCCTGTTTGAGAACCTGG No data
Right 1161474578 19:4477140-4477162 CCTTTGTTTCGGCCTGGGCTGGG No data
1161474570_1161474578 10 Left 1161474570 19:4477107-4477129 CCTGGGGTCTTGAGGTGGCCTGT No data
Right 1161474578 19:4477140-4477162 CCTTTGTTTCGGCCTGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161474578 Original CRISPR CCTTTGTTTCGGCCTGGGCT GGG Intronic