ID: 1161476961

View in Genome Browser
Species Human (GRCh38)
Location 19:4491523-4491545
Sequence ATGCTCAGTGATGGGAAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 16859
Summary {0: 1, 1: 0, 2: 13, 3: 687, 4: 16158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161476961_1161476966 4 Left 1161476961 19:4491523-4491545 CCGGCCTTCCCATCACTGAGCAT 0: 1
1: 0
2: 13
3: 687
4: 16158
Right 1161476966 19:4491550-4491572 GCCGTTCCCCTTCCAGATGTCGG 0: 1
1: 0
2: 0
3: 8
4: 98
1161476961_1161476972 25 Left 1161476961 19:4491523-4491545 CCGGCCTTCCCATCACTGAGCAT 0: 1
1: 0
2: 13
3: 687
4: 16158
Right 1161476972 19:4491571-4491593 GGTCTCGAAACGAGCCCGAAAGG 0: 1
1: 0
2: 0
3: 0
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161476961 Original CRISPR ATGCTCAGTGATGGGAAGGC CGG (reversed) Intronic
Too many off-targets to display for this crispr