ID: 1161480310

View in Genome Browser
Species Human (GRCh38)
Location 19:4507062-4507084
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 5, 1: 4, 2: 5, 3: 54, 4: 278}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161480305_1161480310 2 Left 1161480305 19:4507037-4507059 CCAGGGGCTTCCCCCAGTTGTGA 0: 1
1: 0
2: 2
3: 16
4: 173
Right 1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG 0: 5
1: 4
2: 5
3: 54
4: 278
1161480302_1161480310 14 Left 1161480302 19:4507025-4507047 CCCTACTCTCCACCAGGGGCTTC 0: 1
1: 0
2: 1
3: 15
4: 182
Right 1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG 0: 5
1: 4
2: 5
3: 54
4: 278
1161480303_1161480310 13 Left 1161480303 19:4507026-4507048 CCTACTCTCCACCAGGGGCTTCC 0: 1
1: 0
2: 7
3: 25
4: 286
Right 1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG 0: 5
1: 4
2: 5
3: 54
4: 278
1161480307_1161480310 -9 Left 1161480307 19:4507048-4507070 CCCCAGTTGTGACAACCACAGAT 0: 5
1: 13
2: 134
3: 436
4: 922
Right 1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG 0: 5
1: 4
2: 5
3: 54
4: 278
1161480308_1161480310 -10 Left 1161480308 19:4507049-4507071 CCCAGTTGTGACAACCACAGATG 0: 7
1: 29
2: 202
3: 586
4: 993
Right 1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG 0: 5
1: 4
2: 5
3: 54
4: 278
1161480306_1161480310 -8 Left 1161480306 19:4507047-4507069 CCCCCAGTTGTGACAACCACAGA No data
Right 1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG 0: 5
1: 4
2: 5
3: 54
4: 278
1161480304_1161480310 5 Left 1161480304 19:4507034-4507056 CCACCAGGGGCTTCCCCCAGTTG 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG 0: 5
1: 4
2: 5
3: 54
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900146487 1:1161031-1161053 ACCACCGAAGCCCCCAGACCGGG + Intergenic
900195025 1:1371718-1371740 ACCACAGATGTCTCCAGATGCGG + Intergenic
900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG + Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901514463 1:9735674-9735696 ACCACAGATGCCTCCACAAAGGG + Intronic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
904205739 1:28854158-28854180 ACTACAGATGTGGCCAGACCCGG + Intronic
904720382 1:32503289-32503311 ACCACATGAGGCCCCAGACACGG + Intronic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
913070207 1:115291846-115291868 ACAACACATCTCCCCAGGCATGG - Intronic
915011100 1:152686992-152687014 ACCACAGCAGCCCCCAGAGATGG - Exonic
915579502 1:156805002-156805024 ACCACAGGAGTCCCCAGGCCTGG + Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
916551625 1:165855331-165855353 AGCAAAGATGTCCCCAAATAAGG + Intronic
916691779 1:167196855-167196877 ACCACAGAGCCCCCCAGAAAGGG + Intergenic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
921800029 1:219392100-219392122 AAGACAGATGACCCCAAACAGGG - Intergenic
922584756 1:226725260-226725282 AGCACAGGTGTCTGCAGACAAGG + Intronic
923508106 1:234624196-234624218 TCCACTGAGGTCCCCAGAAAGGG - Intergenic
923857356 1:237859368-237859390 TCCACACATGTCCACAGAGAGGG + Intergenic
1063364204 10:5480028-5480050 ACCACAGCTGTCCCCTGCCACGG + Intergenic
1063364221 10:5480116-5480138 ACCACAGCTGTCCCCTGCCATGG + Intergenic
1063364231 10:5480160-5480182 ACCACAGCTGTCCCCTGCCACGG + Intergenic
1064496015 10:15911322-15911344 ATCACCGATGGCCACAGACAGGG - Intergenic
1064639694 10:17403113-17403135 CCCACAGATTACCCCAAACAGGG + Intronic
1066186769 10:33016976-33016998 AAAACAGATGTCCCCAAAGAGGG - Intergenic
1068237583 10:54259295-54259317 ACCTAAGGTGACCCCAGACAGGG - Intronic
1068588315 10:58826329-58826351 ACCACATGAGTTCCCAGACACGG + Intronic
1068984417 10:63094085-63094107 AACAAAAATGTCCCCAAACATGG + Intergenic
1069678992 10:70270406-70270428 CCCACAGATCCCCCCAGTCATGG - Intronic
1069858667 10:71456464-71456486 GCTCCAGATGTGCCCAGACAGGG - Intronic
1070549053 10:77476284-77476306 AACAAAGATGGCCCCAGAAAGGG + Intronic
1072000926 10:91194944-91194966 ATCACAAATGCCCCCACACATGG - Intronic
1073708445 10:106013360-106013382 CTCACATATGTCCTCAGACATGG + Intergenic
1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG + Intergenic
1075792428 10:125094612-125094634 ACCAGAGATGTCGCCAGATAGGG - Intronic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1076721078 10:132393552-132393574 ACCACAGATTTCTCCAGAGCTGG - Intergenic
1076803827 10:132845334-132845356 TCCAGAGATGTCTGCAGACATGG - Intronic
1076836825 10:133025392-133025414 GCCAGTGCTGTCCCCAGACAGGG - Intergenic
1077131137 11:973259-973281 ACCAAAAATGCCCCAAGACACGG - Intronic
1077220598 11:1413790-1413812 GCCACTGATGCCCCCAGAGATGG - Intronic
1077240734 11:1509118-1509140 CCAACAGCTGTCCCCACACAGGG + Intergenic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078270742 11:9792524-9792546 ACCACAGGTGTTCCTAAACAAGG + Intronic
1079910028 11:26298409-26298431 ACAACAGAAGTCCCTACACATGG + Intergenic
1079980101 11:27142037-27142059 AACTCATATGTCCCCATACAAGG + Intergenic
1081714359 11:45238003-45238025 AGCACAGATGGCCCCTGGCAGGG - Intergenic
1081747034 11:45480683-45480705 CCCACAGCTGTCCCCAGGGAAGG + Intergenic
1081748070 11:45487032-45487054 AAGACAGATGTCCCCATTCAAGG + Intergenic
1082963287 11:58939574-58939596 ACCACAGCTGGCCCCAACCATGG + Intronic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1083925633 11:65804328-65804350 CCCACAGAGGTCCCTACACAAGG - Intergenic
1084146836 11:67269522-67269544 ACAGCCGATGGCCCCAGACAAGG - Intronic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084348460 11:68575008-68575030 ACCACAGTTGTCACCAGGGATGG + Intronic
1084359626 11:68661088-68661110 ACCAGCGATGTCTCCAGACATGG + Intergenic
1084403895 11:68960142-68960164 AGCACAGATGGCCCTGGACAGGG - Intergenic
1084405226 11:68968212-68968234 GCCACATATGTCCCCAGTCCTGG + Intergenic
1084696351 11:70757855-70757877 ACAACAAATGACCCCAGACCAGG + Intronic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1087059004 11:93960391-93960413 ACCACTCAGGTCCCTAGACATGG + Intergenic
1088361974 11:109001031-109001053 ACCACTGATGTTCCCTTACATGG + Intergenic
1088364018 11:109019981-109020003 ACCACAGATGGTCGCAGACTTGG + Intergenic
1089121082 11:116135741-116135763 ACAACAGATCTCCCCTCACAGGG + Intergenic
1089179958 11:116576662-116576684 ACCACAAATGTCTCCAGAGTGGG - Intergenic
1089226795 11:116930931-116930953 TCCAAACATGTACCCAGACAGGG + Intronic
1089512762 11:119010896-119010918 TCCACAGATGGACCCAGGCAGGG + Intronic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1091232312 11:133996653-133996675 CACACAGCTGTCCCCAGAGAGGG + Intergenic
1091313860 11:134596914-134596936 ATCAGAGAAGGCCCCAGACATGG + Intergenic
1092002488 12:5044018-5044040 ACCCCAGCTCTCCCCAGAGAGGG + Exonic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1092946211 12:13456745-13456767 ACCAGAGAAGTCACCAGAAAGGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1095662920 12:44758952-44758974 AACATAGATGGCCTCAGACATGG + Intronic
1095727573 12:45470078-45470100 ACCACAGATCTCCCCAGCCCCGG + Intergenic
1096984604 12:55748100-55748122 AACACAGATGGCCTCAGAGAGGG - Intronic
1097966758 12:65589993-65590015 ACTACAAATGGCCTCAGACATGG - Intergenic
1098708019 12:73715964-73715986 AACAAAGATGTCCCCAAACAAGG - Intergenic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102908895 12:116697534-116697556 ACCCCGAATGTCTCCAGACATGG - Intergenic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1107731735 13:43355866-43355888 TCCACAGGGATCCCCAGACACGG - Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1109194559 13:59363814-59363836 ACCACAGAAGTTCTCAGAGAAGG + Intergenic
1112195728 13:97224323-97224345 AGCACAGATGGCCCCAAGCAGGG + Intronic
1113117322 13:106887081-106887103 AACATAGATGGCCCCTGACAGGG - Intergenic
1113392044 13:109907329-109907351 CCCACACACCTCCCCAGACAAGG - Intergenic
1114194640 14:20466387-20466409 ACCACAGATGCCACCACACCTGG + Intergenic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1118056957 14:62088924-62088946 ACCACAGAAGTCCCTATGCATGG - Intronic
1119732015 14:76957038-76957060 AACACAGATGCCCACAGACAGGG - Intergenic
1120215208 14:81674697-81674719 AATACAGATGTCCCCACTCAGGG - Intergenic
1120681355 14:87484691-87484713 GCCAGAGATGTCCCGAGAAATGG + Intergenic
1121640188 14:95480166-95480188 CCCAGGGATGTCCCCAGACAGGG - Intergenic
1121650213 14:95552667-95552689 GCCACAGCTGTAGCCAGACATGG + Intergenic
1121664134 14:95659030-95659052 CCCACTGATGCCCCCAAACAGGG - Intergenic
1121744814 14:96279806-96279828 GCCAAAGACGTCTCCAGACATGG - Intergenic
1122891154 14:104732869-104732891 ACCACATATGTGCCGAGGCAAGG + Intronic
1122994459 14:105255392-105255414 ACCCCAGATGCCACCTGACACGG + Intronic
1123430190 15:20208360-20208382 AACACTGAGGTACCCAGACAAGG + Intergenic
1123980452 15:25597280-25597302 ACCAGAGCTGTCCAGAGACACGG - Intergenic
1125071397 15:35558105-35558127 ACCACAGATGCCACCATACCTGG - Intergenic
1129156676 15:73722462-73722484 ACCACACTTGTCACCAGACCTGG - Intergenic
1129221114 15:74132152-74132174 AACACATATGCACCCAGACATGG - Intronic
1129720169 15:77873505-77873527 GCCCCAGCTGTCACCAGACAGGG - Intergenic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131440876 15:92458735-92458757 ACCACAGCTGCCCAGAGACAGGG + Intronic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1132612552 16:824541-824563 ACCACATTTGTCCACAGACTCGG - Intergenic
1132861180 16:2072562-2072584 ACGTCAGAGGTCCCCAGCCAAGG + Intronic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1136067754 16:27770199-27770221 AACCCAAATGTCCCCAGACAAGG - Intronic
1136143382 16:28301372-28301394 ACCAAAGATGTGCCCCGAGAAGG + Intronic
1136854447 16:33642847-33642869 AACACTGAGGTACCCAGACAAGG - Intergenic
1137294064 16:47073409-47073431 AGCAAAACTGTCCCCAGACATGG - Intergenic
1138662761 16:58533837-58533859 ACCACTGATGTGGCCAGGCATGG + Intronic
1139956977 16:70697834-70697856 GCCCCAGATGCCCCCAGACATGG + Intronic
1140137758 16:72222915-72222937 ACTGCAGCTGTCCCCAGAAATGG - Intergenic
1140934502 16:79658024-79658046 AACAAATATGTCCCCAAACATGG + Intergenic
1141455464 16:84138707-84138729 ACCACAACTGTCCCCAAACTAGG + Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1203116026 16_KI270728v1_random:1491305-1491327 AACACTGAGGTACCCAGACAAGG - Intergenic
1142575984 17:908006-908028 ACCACAGGTGTCTCTAGAGAGGG - Intronic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1148766826 17:50044383-50044405 ATCACAGAGGACCCCAGAAAAGG - Intergenic
1151495250 17:74454633-74454655 ACCACAAATGTCTCTGGACACGG + Intergenic
1152232148 17:79119222-79119244 ACCACAGATGCCCTCAGATCTGG - Intronic
1152445098 17:80337826-80337848 TTCACAGATTTCCCCAGACACGG + Exonic
1152807427 17:82362795-82362817 ACAGAAGATGACCCCAGACAGGG + Exonic
1155285262 18:24281797-24281819 ACAACAGGAGTCCCCAGACCCGG + Intronic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1160538812 18:79609690-79609712 GCCACTGGTGTCCCCAGAAAAGG + Intergenic
1160802400 19:976459-976481 ACCACAAATGCCCCCAGACATGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1160891188 19:1379599-1379621 ACCACAGATGTCCCCAGACGTGG + Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161121215 19:2527810-2527832 AGCACAAATGTCCCCAGACTTGG + Intronic
1161126583 19:2561250-2561272 GCCACAGATGTCCCCAGACATGG - Intronic
1161143856 19:2665326-2665348 GCCACAAATGTCCCCAGACATGG + Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161265787 19:3363752-3363774 ACCACAAATGTCCTTAGACATGG - Intronic
1161279894 19:3440301-3440323 ACCGTAAATGTCCCCAGACCTGG + Intronic
1161314196 19:3610310-3610332 ACCACGAATGCCCCCAGGCATGG + Intergenic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161477944 19:4496638-4496660 ACCACAGATGTCCCCGGACGTGG - Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161507322 19:4650827-4650849 ACCACACCTGGCCCCCGACAGGG - Intronic
1161515309 19:4693096-4693118 ACCACAGATGTCCCTAGATGTGG - Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161572398 19:5037765-5037787 GCCACAGACATCCCCAGACATGG + Intronic
1161582678 19:5089357-5089379 GCTACAGATATCCCTAGACATGG - Intronic
1161652095 19:5491707-5491729 AGCACAAATACCCCCAGACATGG - Intergenic
1161725727 19:5927439-5927461 ACCACAAATGTCCCCAGACGTGG - Intronic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1161943258 19:7419025-7419047 ACCCCAGATGTACCCACACTCGG + Intronic
1161943265 19:7419055-7419077 ACCCCAGATGTACCCACACTCGG + Intronic
1161943278 19:7419114-7419136 ACCCCAGATGTACCCACACTCGG + Intronic
1161943293 19:7419174-7419196 ACCCCAGATGTACCCACACTCGG + Intronic
1161964831 19:7542047-7542069 ACCTGAGATGTCCCCTGGCATGG - Exonic
1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG + Intronic
1163283103 19:16329217-16329239 ACCAAAAATGTTCCCAGACTGGG - Intergenic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1163497322 19:17654553-17654575 AACACAGCTGTCCCCAGCCCAGG + Intronic
1165648740 19:37467778-37467800 ACCTCAGATGTCACTGGACAGGG - Intronic
1167434424 19:49470895-49470917 ACCCCCGAGGACCCCAGACAGGG + Exonic
1167663088 19:50807863-50807885 CCCAAAGATGGCCCCAGAGAGGG + Intergenic
1168504895 19:56925333-56925355 ATCACAAATTTCTCCAGACATGG - Intergenic
925131315 2:1496051-1496073 GTCACAGATGACCCGAGACAGGG - Exonic
925991722 2:9259977-9259999 ACCACAGAGTTTCCCAGATAGGG - Intronic
926428228 2:12759301-12759323 ACCTCAGGTGTCCCCATGCATGG + Intergenic
926549535 2:14284926-14284948 ACTTCAGATATCCCCAGACAAGG - Intergenic
927554028 2:24020127-24020149 ACCACACATGTCCCCAGCTCAGG - Intronic
927554497 2:24022558-24022580 ACCACACATGTCCCCAGCTCAGG - Intronic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
929616319 2:43311906-43311928 ACCACAGATGTGGCCGGTCATGG + Intronic
931809100 2:65837087-65837109 ACCACAGATCAATCCAGACACGG - Intergenic
931939586 2:67237539-67237561 TTGACACATGTCCCCAGACAGGG + Intergenic
933136113 2:78737763-78737785 ACCACAGAGTTCACCAGGCAGGG - Intergenic
935262472 2:101367192-101367214 ACAACAGATGGCACCAGAAAAGG + Intronic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
937926928 2:127174836-127174858 GCCAGAGAAGTCCCCAGAGAAGG + Intergenic
939176819 2:138758735-138758757 ACATCAGATTTCTCCAGACATGG - Intronic
939541894 2:143504575-143504597 AGCACAAATGTCCCAAGTCATGG + Intronic
939629277 2:144514917-144514939 GCCAGAGATGTCCGCAGTCATGG - Intronic
942978077 2:182043505-182043527 TCCACATATATGCCCAGACATGG + Intronic
945497645 2:210528614-210528636 ACCACTGAGATCCCCAGACTTGG - Intronic
946184864 2:217974852-217974874 ACTACAGATGCCCAGAGACAGGG - Intronic
947166229 2:227264668-227264690 ACCACACCTGGCCCCAGAAAAGG - Intronic
947503859 2:230692019-230692041 ACCACAGCCGTCCCTAGACAAGG + Intergenic
947588793 2:231372831-231372853 ACCAGAGATGTCCCCATTGAAGG - Intronic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
947847968 2:233260866-233260888 GGCAAAGATTTCCCCAGACAAGG - Intronic
949011394 2:241681118-241681140 ATCACAGATGTACAAAGACACGG + Intronic
1171006035 20:21466757-21466779 ACCCATGATGTCCCAAGACAGGG + Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1174120380 20:48260513-48260535 GCCTCAGATGTCCCCAGCCTGGG + Intergenic
1174355391 20:49994336-49994358 AGCCCAGATGTGCCCAGAGATGG - Intergenic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175225656 20:57442425-57442447 ACCACAGACATCCCCAGGCCGGG - Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175914747 20:62420544-62420566 AACACATATGTACACAGACAGGG + Intronic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179382241 21:40910594-40910616 ACCACATGTGTCCCTACACACGG - Intergenic
1179992211 21:44953936-44953958 ACCACCGCCGTCCCCATACATGG - Intronic
1180971914 22:19820306-19820328 ACCTCAGATGTCACCAGCCCTGG + Intronic
1181023785 22:20116611-20116633 ACCCCATCTGTCCCCACACAGGG - Exonic
1181407590 22:22695587-22695609 ACCACAGATGCACCCCCACAGGG + Intergenic
1181541502 22:23575398-23575420 GCCACAAGTGTCCCCAGTCAAGG + Intronic
1181618403 22:24070957-24070979 ACCACTGCTGTCCGCAGAGAGGG - Exonic
1181726813 22:24817111-24817133 ACCACAGATGTCCACATCAAAGG + Intronic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1181796879 22:25317904-25317926 GCCACAAGTGTCCCCAGTCAAGG - Intergenic
1182079536 22:27519084-27519106 GCCACAGATCTCCCCAGGGAAGG - Intergenic
1183240424 22:36653673-36653695 GCCACAGGTGTCTGCAGACATGG + Intronic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1184015658 22:41784063-41784085 ACCACAGATGAGGCCAGAGAAGG + Intronic
1184457219 22:44617878-44617900 ACCACACATGTACACACACACGG + Intergenic
949944744 3:9180967-9180989 ACAACAGATGTCTGGAGACACGG + Intronic
950259722 3:11535261-11535283 ACCTCAGATGACACCAGGCAGGG - Intronic
950417704 3:12877656-12877678 ACCACAGATGCTCCCTGGCAGGG - Intergenic
950850337 3:16056293-16056315 ACCAGAGATGTGGCCAGAGAGGG - Intergenic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956087947 3:65633248-65633270 ACCACACATGACTCCAGACACGG + Intronic
956903615 3:73742536-73742558 GGCACAGAGGTCCCCAGATATGG - Intergenic
958632868 3:96703725-96703747 AACACAGAGGCGCCCAGACATGG + Intergenic
959765250 3:110019014-110019036 ACCACAGATGTATCTAGAAATGG - Intergenic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962433776 3:135346170-135346192 ACCACACAAGTCCCAAGACTGGG - Intergenic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964880710 3:161419652-161419674 ACCACAACTATCTCCAGACATGG + Intergenic
967791470 3:193553577-193553599 TCCACAAATGTCACCAGAAATGG - Intronic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969087273 4:4665839-4665861 GACACAGACATCCCCAGACATGG + Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969589930 4:8115979-8116001 ACCACAGAAGTCCCCACGGATGG + Intronic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
970178175 4:13360099-13360121 ACCAAAGATGTCCCCAGTAAAGG - Intergenic
973695327 4:53484909-53484931 ACTTCTGATCTCCCCAGACAAGG + Intronic
973730189 4:53815642-53815664 GCCACAGAAGTCCTCAGATAGGG - Intronic
974142873 4:57909967-57909989 ACCACATCTGTGGCCAGACACGG + Intergenic
974827310 4:67147994-67148016 ACAGCAGCTGTCCCCAGGCAAGG - Intergenic
974844859 4:67340053-67340075 AGCCCAGATGTCCCCACAGATGG + Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
979481137 4:121218907-121218929 ACCACAGAAGTGGCCAGCCATGG + Intronic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
988563072 5:32298278-32298300 ACCACAGAGGGCCCCACAAAGGG + Intronic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
991611877 5:68457928-68457950 ACCAGAAATGTTGCCAGACATGG + Intergenic
992660928 5:78959913-78959935 ACCACAGCTGTTCACAGGCAGGG - Intronic
992736858 5:79730409-79730431 ACCACATATGTCCCCTGAAGTGG + Exonic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993266087 5:85728168-85728190 ATCACAGATGTCCTCATAAAGGG - Intergenic
994827871 5:104739222-104739244 ACCACAGTTATCCTCAGAAAAGG + Intergenic
995434416 5:112119800-112119822 ACCACAAATCTCTCCAGAAAAGG + Intergenic
996201957 5:120686372-120686394 AAGACAGATGTCCCCAGGCAGGG + Exonic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
1001901361 5:175432950-175432972 ACCACAGAGGTGCACAGTCACGG + Intergenic
1003198608 6:3938199-3938221 CCCACTGCTGCCCCCAGACATGG - Intergenic
1003377120 6:5589653-5589675 ACCACTGGTGTTCCCAGATATGG - Intronic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1004802017 6:19158987-19159009 ATCACAGATGACTCCAGTCATGG + Intergenic
1005887459 6:30107715-30107737 ACCAGAGATGGCCTCAGGCAGGG - Intronic
1005895149 6:30171770-30171792 ACCACAGATGTTCCTAGAGCAGG - Intronic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1009037698 6:58137809-58137831 AACAAAAATGTCCCCAGATATGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009947311 6:70354732-70354754 CCCACAAATCTCCCAAGACATGG - Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1014268362 6:119308192-119308214 ACCACATTTTTCCACAGACAAGG + Intronic
1014593720 6:123306284-123306306 CCCAAACATTTCCCCAGACATGG + Intronic
1017205099 6:151796395-151796417 ACCTCAGCTGTCTCCAGAGAGGG + Intronic
1018208585 6:161458733-161458755 ACTACAGAATTCCACAGACATGG - Intronic
1019496078 7:1341258-1341280 CCCAAAGAAGTCCCCAGCCATGG - Intergenic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1021342380 7:19480464-19480486 ACCACAGAGAGCCCCTGACAGGG + Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021585047 7:22198946-22198968 ACCACAGATGTCCCCTAAGATGG + Intronic
1022282773 7:28927606-28927628 AACACAAATCTCTCCAGACAAGG - Intergenic
1023365966 7:39463975-39463997 ACCACACAGGTGCACAGACAGGG - Intronic
1025952626 7:66157506-66157528 ACCACACCTGGCCCCAGACAAGG - Intergenic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1031312392 7:120215204-120215226 ACCACAGTTTTGCCCATACATGG - Intergenic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1037766190 8:21773838-21773860 AACAAAGATGTCCCCAGACAGGG - Intronic
1038046085 8:23766539-23766561 ACCACAGATGTATCCAGGCTTGG + Intergenic
1038464058 8:27743602-27743624 ACCACACTTGTCCCCTGATATGG - Intronic
1041188973 8:55333731-55333753 TCTGAAGATGTCCCCAGACAAGG + Intronic
1041392029 8:57355347-57355369 GCCACACAGGTCCCCATACATGG + Intergenic
1042925745 8:73966761-73966783 ACCACACATAGCCCAAGACATGG + Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1048801161 8:138194888-138194910 TGCACAGATGGCCTCAGACATGG - Intronic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1058896940 9:109408682-109408704 AACGCAGATGCCCCCAGAGAGGG + Intronic
1059102203 9:111482854-111482876 ACCACCGCTCTCCCCAGACAGGG + Intronic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060174898 9:121490469-121490491 ACCACTGATGCCACCAGAGATGG - Intergenic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061481207 9:130898537-130898559 GTCACAGAGGTCCTCAGACAAGG - Intergenic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061878471 9:133556673-133556695 TGCCCAGGTGTCCCCAGACATGG - Intronic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1189366799 X:40395145-40395167 ACCAGAGATGTCCCCAGTTGAGG + Intergenic
1192081122 X:68048887-68048909 CCCCAAGCTGTCCCCAGACATGG - Intronic
1192604335 X:72499224-72499246 AACACAGATGTACTAAGACAAGG + Intronic
1194467915 X:94255885-94255907 ACCAAGCATGGCCCCAGACATGG + Intergenic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196902211 X:120396043-120396065 ACCACAGATTACCACAGACTGGG - Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201550991 Y:15216260-15216282 ATGAAAAATGTCCCCAGACATGG - Intergenic