ID: 1161480954

View in Genome Browser
Species Human (GRCh38)
Location 19:4510452-4510474
Sequence CTTCCACCCCATGAATGCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161480954_1161480965 25 Left 1161480954 19:4510452-4510474 CCTCCGCATTCATGGGGTGGAAG 0: 1
1: 0
2: 2
3: 20
4: 118
Right 1161480965 19:4510500-4510522 TCTGCAGCATTGCCAAGCGTGGG 0: 1
1: 0
2: 0
3: 8
4: 91
1161480954_1161480964 24 Left 1161480954 19:4510452-4510474 CCTCCGCATTCATGGGGTGGAAG 0: 1
1: 0
2: 2
3: 20
4: 118
Right 1161480964 19:4510499-4510521 TTCTGCAGCATTGCCAAGCGTGG 0: 1
1: 0
2: 0
3: 8
4: 109
1161480954_1161480966 26 Left 1161480954 19:4510452-4510474 CCTCCGCATTCATGGGGTGGAAG 0: 1
1: 0
2: 2
3: 20
4: 118
Right 1161480966 19:4510501-4510523 CTGCAGCATTGCCAAGCGTGGGG 0: 1
1: 0
2: 1
3: 13
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161480954 Original CRISPR CTTCCACCCCATGAATGCGG AGG (reversed) Exonic
905971289 1:42144461-42144483 CATCAATCCCATGAATGCGGTGG + Intergenic
907083327 1:51644929-51644951 TTTCCAACACATGAATGCTGGGG - Intronic
908830747 1:68176039-68176061 CTTCGTTCCCATGAATGAGGAGG + Intronic
910463910 1:87476246-87476268 CTTTCATCCCAAGAATTCGGAGG - Intergenic
913186658 1:116374681-116374703 CTTTCACCCCATGAACTCCGAGG - Intronic
915870438 1:159554461-159554483 CTCAAACCCCATGAATGTGGGGG + Intergenic
918759309 1:188381232-188381254 CTTCCACCACATGAGTGTGCTGG - Intergenic
919160029 1:193817134-193817156 CTTCCACCACATGGCTGCGCTGG - Intergenic
920695756 1:208180307-208180329 CTCCCACCGCTTGAATGCAGAGG - Intronic
921230978 1:213070538-213070560 CTTCCACCACATGGTTGCGCTGG - Intronic
1063187158 10:3661914-3661936 CTTCCACCCCATGGCTGCGCTGG - Intergenic
1077894619 11:6444317-6444339 CTTCCAACACATCAATTCGGAGG - Intergenic
1084095572 11:66908959-66908981 CTTCCAGCCCATGAAGGAAGGGG + Intronic
1084545480 11:69813112-69813134 CTTCCACCCCATGAAGGGTGGGG + Intronic
1085460567 11:76690561-76690583 CTTCCACCCCATCAGTGGGCAGG - Intergenic
1086894940 11:92301353-92301375 CTTCCACCACTTGAGTGCAGAGG + Intergenic
1087696454 11:101382549-101382571 CTTCCAACACATGAATTCTGGGG - Intergenic
1088999287 11:115037179-115037201 CTTCCACCACATGGCTGCGCTGG + Intergenic
1089141876 11:116291815-116291837 CTTCCACCACATGGCTGCGCTGG - Intergenic
1091323547 11:134667986-134668008 CTTTCCCCCCATGAATGCTGGGG + Intergenic
1091968119 12:4762881-4762903 CTTCCACCACATGGCTGCGCTGG - Intronic
1092506935 12:9112158-9112180 CTTTCACCCCCTGAATGAGTTGG - Exonic
1093653085 12:21666057-21666079 CTTCCACCACATGGCTGCGCTGG - Intronic
1094848602 12:34372383-34372405 CTTCCCCACCATGCATGCGTGGG - Intergenic
1101397485 12:104361191-104361213 CTTCCAACCAATGAATGAGCAGG + Intergenic
1101414744 12:104499364-104499386 TTTCCACTCCATGAAGGCAGGGG - Intronic
1102040985 12:109800633-109800655 CTTCCAGCCCAAGGATGAGGGGG - Exonic
1106157450 13:27171654-27171676 CTTCCACCCAATCACAGCGGCGG + Exonic
1112412946 13:99179552-99179574 TTTCCAGCCCATGAATACGGGGG - Intergenic
1117853078 14:59995695-59995717 CTTCCACCCCTTGAAAACAGGGG - Intronic
1122861923 14:104586632-104586654 CCTCCACCCCAGGAATCAGGGGG + Intronic
1202840967 14_GL000009v2_random:120854-120876 CTTCCACCACATGACTGTGCTGG + Intergenic
1202910352 14_GL000194v1_random:111082-111104 CTTCCACCACATGACTGTGCTGG + Intergenic
1202882223 14_KI270722v1_random:71414-71436 CTTCCACCACATGACTGCGCTGG - Intergenic
1124039554 15:26088067-26088089 CTTCCACCCCATGGCTGTGCTGG - Intergenic
1125753900 15:42049443-42049465 TTTCCAACACATGAATGCTGGGG + Intronic
1126053278 15:44707030-44707052 CTTCCACCCCAGGCCTGTGGTGG + Intronic
1127597884 15:60504845-60504867 CTTCCACCCCATCATATCGGTGG - Intronic
1128795390 15:70462915-70462937 CCTCCACCCCATGCCTCCGGAGG + Intergenic
1128874339 15:71189952-71189974 CTTCCACCCCAGCAGTGCGTGGG - Intronic
1139625583 16:68185908-68185930 CTTTCAGCCCATGAATTGGGAGG + Intronic
1143654432 17:8285666-8285688 CTTCCACCCCATTCATTCAGAGG + Intergenic
1144771714 17:17763149-17763171 TTCCCACCCCAGGAAAGCGGGGG - Intronic
1149454924 17:56780150-56780172 CCTCCAGCCCAGGAATGCGAAGG + Intergenic
1154365805 18:13707921-13707943 CTTCCACCACATGGCTGCGCAGG + Intronic
1155303122 18:24451582-24451604 CTTCCACCCCAGAAATGTGTTGG + Exonic
1155663681 18:28281902-28281924 CTTCCACCCCAGGTCTGCGATGG - Intergenic
1156109202 18:33703404-33703426 CATCCACCCTATGAATGAGCTGG + Intronic
1156423303 18:36979866-36979888 TTTCCAACACATGAATGTGGGGG - Intronic
1157618151 18:48999863-48999885 CTTCCACCCCTTGGCTGTGGTGG + Intergenic
1158422835 18:57311464-57311486 CTTCCACCACATGGCTGCGCTGG + Intergenic
1158678852 18:59548396-59548418 CTTCCAGCCTATGAAGGAGGTGG + Intronic
1159389080 18:67765190-67765212 CTTCCACCACGTGACTGTGGTGG - Intergenic
1160222295 18:76986021-76986043 CTTCCTCCCCATGTTTGCAGTGG - Intronic
1160467068 18:79087302-79087324 CTTCCAACACATGAATTTGGAGG + Intronic
1161371326 19:3913569-3913591 CTTGCACCCCATGCATGGAGTGG - Intronic
1161480954 19:4510452-4510474 CTTCCACCCCATGAATGCGGAGG - Exonic
1162706628 19:12559933-12559955 CTTCCTCCACATGAAAGCGGAGG - Intronic
1202631344 1_KI270706v1_random:2916-2938 CTTCCACCACATGACTGCACTGG - Intergenic
1202657834 1_KI270708v1_random:40512-40534 CTTCCACCACATGACTGCGCTGG - Intergenic
925898684 2:8493250-8493272 CTGCCACCCCAGGACTGCTGGGG + Intergenic
929670551 2:43873823-43873845 CCTCCGCCCCATGGATGAGGAGG - Exonic
931288837 2:60854893-60854915 CTTCCACTCCATGATTGAGTAGG + Intergenic
931290518 2:60869181-60869203 CTTCCAACACATGAATGTTGAGG + Intergenic
935823913 2:106922805-106922827 CTTCCAACACATGAATTCTGGGG - Intergenic
937466450 2:122137168-122137190 TTTCCACCACATGAATCTGGGGG + Intergenic
939497221 2:142938381-142938403 CTTCCACCACGTGGCTGCGGTGG - Intronic
941038320 2:160591049-160591071 CTTCCACCCCATGACTGCACTGG + Intergenic
945049289 2:205807825-205807847 CTCCCACCACATGGATGCAGAGG + Intergenic
946161088 2:217836507-217836529 CTTCCAACCCCTGGAGGCGGAGG + Intronic
1168840532 20:907258-907280 CTGCCACCCCATGAAAGGTGAGG - Intronic
1170742056 20:19066790-19066812 CTTCCAACACATGAATTTGGGGG - Intergenic
1175330117 20:58157932-58157954 CCTCCATCCCAAGAATACGGTGG + Intronic
1176597726 21:8762851-8762873 CTTCCATCACATGACTGCGCTGG - Intergenic
1176629708 21:9125783-9125805 CTTCCACCACATGACTGTGCTGG + Intergenic
1176643561 21:9328856-9328878 CTTCCACCACATGACTGCACTGG - Intergenic
1178097661 21:29233352-29233374 CTTCCACCACATGGCTGCGCTGG + Intronic
1178240793 21:30897857-30897879 CTTGCACACGATGAATGCGTAGG - Intergenic
1179583370 21:42359289-42359311 CTTCCACCCCGTGACTGTGCTGG + Intergenic
1180369369 22:11970365-11970387 CTTCCACCACATGACTGCACTGG + Intergenic
1180376859 22:12101750-12101772 CTTCCACCACATGACTGCGCTGG - Intergenic
1180420713 22:12811945-12811967 CTTCCACCACATGAATGCGCTGG + Intergenic
1182829269 22:33291484-33291506 CTTCCAACACATGAATGTTGGGG - Intronic
1184456296 22:44611637-44611659 CTTCCACACCATGACAGGGGTGG + Intergenic
949341766 3:3038255-3038277 CTTCCACCTCAGGATTGCTGAGG - Intronic
949410752 3:3761491-3761513 CTTCCACCACATGGATGCACTGG - Intronic
949898662 3:8791952-8791974 CTTCCTTCCCATGAAGGCAGTGG + Intronic
954807521 3:53229179-53229201 ATTCCAGCCCATGGATGGGGGGG - Intronic
960054560 3:113267968-113267990 CTTACACCCCAGAAATGGGGGGG - Intronic
961242016 3:125419292-125419314 CTTCCACCACATCACTGCGATGG + Intergenic
962396544 3:135019334-135019356 CTTCCACCCCAGGACTCTGGGGG + Intronic
962968753 3:140379487-140379509 CATCCACCCCATGAATTGGAAGG + Intronic
1202743321 3_GL000221v1_random:76173-76195 CTTCCACCACATGACTGCACTGG + Intergenic
968878467 4:3286556-3286578 CTTCCACCCCAGGAGGCCGGGGG - Intergenic
969498526 4:7539844-7539866 CTTCCACAGCAGGAATGGGGCGG - Intronic
971079602 4:23195099-23195121 TTTCCAACCCATGAATTCTGGGG + Intergenic
973361029 4:49165105-49165127 CTTCCACCACACGAATGCGCTGG - Intergenic
982541679 4:156679951-156679973 CCTCCACCCCATGAATGCTATGG - Intergenic
1202758458 4_GL000008v2_random:87182-87204 CTTCCACCACATGACTGCGCTGG - Intergenic
987844725 5:23268308-23268330 CTTCCACCACATGGCTGCGCTGG - Intergenic
990091281 5:52052837-52052859 TTTCCAACACATGAATCCGGGGG + Intronic
991216115 5:64158870-64158892 CTTCAACCCAATGAGTGAGGTGG - Intergenic
991352713 5:65735165-65735187 CTGCCACCACATGAATAAGGAGG + Intronic
998503636 5:142654704-142654726 CTTCGACTCCATGAATGTTGTGG + Intronic
999032011 5:148304410-148304432 CTTCCACCACATGACTGCGCCGG - Intergenic
1000086210 5:157889552-157889574 CTTCCTCCCCATGACTGCCTGGG - Intergenic
1004581923 6:16962758-16962780 CTTCCAACACATGAATTTGGAGG - Intergenic
1006937814 6:37730555-37730577 CGTCCTCCCCACAAATGCGGAGG - Intergenic
1007692967 6:43714759-43714781 CCTCCACCCCATGGATGTGTTGG + Intergenic
1008296691 6:49786803-49786825 CTTCCTCCACATGAAAGCGCAGG + Exonic
1011149325 6:84252791-84252813 CTTCCAGCCCAGAAATGGGGAGG - Intergenic
1012553482 6:100485680-100485702 TTTCCACCCCATGAACAAGGAGG - Intergenic
1016680467 6:146823435-146823457 CTGCCTCCCCATGAATTTGGAGG - Intergenic
1016680571 6:146824573-146824595 CTGCCTCCCCATGAATTTGGAGG + Intergenic
1029514526 7:101017325-101017347 CTTCCACCCCGTGCATGTGGGGG + Intronic
1029578506 7:101419867-101419889 CCTCCACCCCAGGTTTGCGGGGG + Intronic
1029600534 7:101560762-101560784 CTTCCTCCACATGATTGCTGTGG - Intergenic
1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG + Exonic
1030422307 7:109323105-109323127 CTTCCACCACATGGCTGCGCTGG + Intergenic
1031529561 7:122859882-122859904 CTTGGACCCCATGGATGTGGAGG + Intronic
1034470853 7:151253660-151253682 CTTACTCCCCATTAATGAGGTGG + Intronic
1038122635 8:24635036-24635058 CTTCCACCACATGGCTGCGCTGG - Intergenic
1038473753 8:27846932-27846954 ATTCTACCCCATAAATGCTGGGG - Intergenic
1048191969 8:132298245-132298267 CTCATACCCCATGAATGCAGAGG - Intronic
1048498059 8:134951731-134951753 TTTCCACCACATGAATTTGGGGG - Intergenic
1049501122 8:142966774-142966796 CTTCCACCCCATGGCTGCACTGG + Intergenic
1053388337 9:37713864-37713886 CTTCCACGCCCTAAATGCGTAGG - Intronic
1053857422 9:42352700-42352722 CTTCCACCGCATGACTGTGCTGG - Intergenic
1054288705 9:63259491-63259513 ATGCCAGCCCATGAAAGCGGCGG + Intergenic
1056594676 9:87997335-87997357 CTTCCAACACATGAATTTGGGGG - Intergenic
1057431206 9:94996014-94996036 CTTCCACCCCCTGCATGTGGAGG - Intronic
1060312000 9:122470685-122470707 ATGCCAGCCCATGAATGCAGCGG + Intergenic
1203690066 Un_GL000214v1:34197-34219 CTTCCACCACATGACTGCGCTGG - Intergenic
1203752542 Un_GL000218v1:93464-93486 CTTCCACCACATGACTGTGCTGG + Intergenic
1203711957 Un_KI270742v1:106136-106158 CTTCCACCACATGACTGCACTGG + Intergenic
1203539244 Un_KI270743v1:72055-72077 CTTCCACCACATGACTGCGCTGG - Intergenic
1203555564 Un_KI270743v1:204468-204490 CTTCCACCACATGAATGCGCTGG + Intergenic
1203646209 Un_KI270751v1:69856-69878 CTTCCACCACATGACTGCGCTGG + Intergenic
1193149909 X:78114106-78114128 CTTCCTCCACATGAAAGCGGAGG - Exonic
1194974566 X:100380434-100380456 CCCCCACCCCATGAAGGCAGGGG + Intronic
1200462490 Y:3474270-3474292 CTTCCACCACATGACTGTGCTGG + Intergenic