ID: 1161480987

View in Genome Browser
Species Human (GRCh38)
Location 19:4510571-4510593
Sequence TTCACCCAAGGGGCCGCCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 88}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161480987_1161480994 12 Left 1161480987 19:4510571-4510593 CCTGGGGCGGCCCCTTGGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1161480994 19:4510606-4510628 AGTCGCAAGGCCCTTGGTAGTGG 0: 1
1: 0
2: 0
3: 7
4: 78
1161480987_1161480995 18 Left 1161480987 19:4510571-4510593 CCTGGGGCGGCCCCTTGGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1161480995 19:4510612-4510634 AAGGCCCTTGGTAGTGGCTGCGG 0: 1
1: 0
2: 1
3: 40
4: 248
1161480987_1161480998 27 Left 1161480987 19:4510571-4510593 CCTGGGGCGGCCCCTTGGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1161480998 19:4510621-4510643 GGTAGTGGCTGCGGCTTCCCAGG 0: 1
1: 0
2: 2
3: 17
4: 184
1161480987_1161480993 6 Left 1161480987 19:4510571-4510593 CCTGGGGCGGCCCCTTGGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1161480993 19:4510600-4510622 CACGTCAGTCGCAAGGCCCTTGG 0: 1
1: 0
2: 0
3: 1
4: 69
1161480987_1161480991 -1 Left 1161480987 19:4510571-4510593 CCTGGGGCGGCCCCTTGGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1161480991 19:4510593-4510615 ACGTCGCCACGTCAGTCGCAAGG 0: 1
1: 0
2: 0
3: 0
4: 6

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161480987 Original CRISPR TTCACCCAAGGGGCCGCCCC AGG (reversed) Exonic
900318830 1:2072587-2072609 GTCGCCCCAGGGGCCTCCCCAGG - Intronic
900633263 1:3649843-3649865 TCCACCCACGCGGCCGCCCCCGG + Intronic
901020754 1:6254183-6254205 GTCACCCACAGGGCCTCCCCAGG + Intronic
902585951 1:17438699-17438721 TTCCCCGAAGGAGCCGCGCCGGG - Intronic
903357366 1:22756351-22756373 TTCTCCCAGGGGACCGTCCCAGG - Intronic
903499898 1:23795095-23795117 TTGGCCCATGGGGCCCCCCCAGG + Exonic
907442922 1:54489571-54489593 TGCCCCCTAGGGGCCGCCGCCGG + Intergenic
916726243 1:167526493-167526515 TGCTCCCAAGGGGCCCTCCCAGG + Intergenic
922935590 1:229419925-229419947 TTTTTCCAAGGGGCAGCCCCGGG - Intergenic
1063905282 10:10774823-10774845 CTCACCCAAGAGGCCTTCCCTGG - Intergenic
1064240295 10:13621391-13621413 GTCACCCTAGGGGCCCCTCCAGG - Intronic
1071293020 10:84200956-84200978 TCCACCCATGTGGCAGCCCCTGG - Intronic
1072734512 10:97869795-97869817 TTCTCCCTAGGGCCAGCCCCTGG + Exonic
1074127382 10:110539792-110539814 TTCAACCAAGGGCCAGCACCAGG - Intergenic
1076201417 10:128561708-128561730 GTCACCCAAGGGGCCACCTTCGG - Intergenic
1077008663 11:370444-370466 TTCACCGAAGGCGCCCCCGCCGG - Intronic
1083226722 11:61290067-61290089 TTTTCCCAAGGAGCCTCCCCTGG + Intronic
1087188622 11:95230465-95230487 TCCGCCCAAGGAGCCGACCCGGG + Intronic
1089581056 11:119482240-119482262 CCGACCCAAGGGGCTGCCCCAGG + Intergenic
1089585916 11:119509399-119509421 TTCAGGCAAGGGGCCACCCAGGG + Intergenic
1091769110 12:3139923-3139945 TGCACCCACGTGGCCTCCCCAGG + Intronic
1100616723 12:96236689-96236711 TGCACCCCAGTGGCGGCCCCAGG + Intronic
1104805405 12:131586444-131586466 GTCACGCAAGGGGGAGCCCCTGG + Intergenic
1105408161 13:20148771-20148793 ATCACCCACGGGGAGGCCCCCGG + Intronic
1108615530 13:52128768-52128790 TTCTCCCCTAGGGCCGCCCCTGG + Intronic
1119633875 14:76258090-76258112 TTCAGCCACGGGGCTGCTCCAGG + Intergenic
1120765295 14:88323019-88323041 TTTACCCACGGGGCCGCGGCCGG - Exonic
1122070883 14:99204604-99204626 TTCATCCCAGGGGCAGTCCCTGG + Intronic
1124600404 15:31128725-31128747 CCCACCCAAGGGGCCAGCCCTGG - Intronic
1124630958 15:31336853-31336875 TGCACCCAAGGTGCTGACCCCGG - Intronic
1128536309 15:68493222-68493244 TTCACCAAAGGGGCCAGCCTTGG - Intergenic
1129332361 15:74834202-74834224 TTCTCCCACGGGGCCAGCCCTGG - Intergenic
1131257490 15:90871826-90871848 TCCACCCTCGGGGCCGGCCCCGG - Intronic
1131284229 15:91044051-91044073 TTCACCCCAGAGGCTGCTCCTGG + Intergenic
1132231475 15:100187708-100187730 TTCACCAAAAGGGCAGCCACGGG + Intronic
1132557902 16:580515-580537 GTCACGCAAGAGGCCTCCCCTGG + Intronic
1136488026 16:30585596-30585618 GTTTCCCATGGGGCCGCCCCTGG - Exonic
1136560451 16:31036067-31036089 ATCACCCCAGGGGCCGCGCGCGG - Intronic
1138599366 16:58045894-58045916 TTCCACCCAGGGGCAGCCCCAGG + Exonic
1139100434 16:63760354-63760376 TTCTCCCCAGAGGCCGCCCATGG - Intergenic
1144626386 17:16846312-16846334 TCCACCCAAGGTGCTGGCCCGGG + Intergenic
1144765013 17:17727834-17727856 TTCACCCCAGGAGACCCCCCGGG + Intronic
1144880047 17:18426408-18426430 TCCACCCAAGGTGCTGGCCCGGG - Intergenic
1145152186 17:20517976-20517998 TCCACCCAAGGTGCTGGCCCGGG + Intergenic
1147214810 17:38892876-38892898 ATCTCCCAAGAGGCCCCCCCGGG - Intronic
1151451318 17:74200034-74200056 GTCACCCAAGGGCCCATCCCTGG - Intergenic
1151910486 17:77079680-77079702 CTCACCCAAAGAGCAGCCCCAGG + Intergenic
1160753821 19:747630-747652 GGGACCCCAGGGGCCGCCCCCGG + Exonic
1161178933 19:2866721-2866743 TTGACCCCATGGGCCTCCCCAGG + Intergenic
1161480987 19:4510571-4510593 TTCACCCAAGGGGCCGCCCCAGG - Exonic
1163763878 19:19151648-19151670 TTCAGGCAAGGGGCCTCTCCAGG + Intronic
1167017585 19:46850917-46850939 TTCACCAAAGGGGCCAGCCTGGG + Exonic
925390998 2:3493892-3493914 TTCTTCCTAGGGGCCTCCCCTGG - Intergenic
927842877 2:26456586-26456608 ATCACCCACTGGGCCGCACCTGG + Exonic
929822715 2:45286229-45286251 TCCATCACAGGGGCCGCCCCAGG + Intergenic
929896749 2:45967379-45967401 TTCACCCCAGGGGACACTCCAGG - Intronic
934629401 2:95900243-95900265 TTCACCCAAGAGGTAGCTCCTGG + Intronic
934629816 2:95905859-95905881 TTCACCCAAGAGGTAGCTCCTGG + Intronic
934630777 2:95918949-95918971 TTCACCCAAGAGGTAGCTCCTGG + Intronic
934991426 2:98924656-98924678 CTCCCCTAAGGGGCCCCCCCAGG + Intronic
935129076 2:100247802-100247824 TTCACCCATGAGACCGCCTCAGG - Intergenic
937286972 2:120760044-120760066 ATCTCACAAGGGGCAGCCCCAGG - Intronic
940116909 2:150219391-150219413 TTCACCCAAGCACCTGCCCCAGG - Intergenic
946334894 2:219029957-219029979 GTGACCCCAGGGGCCTCCCCTGG - Intronic
948875673 2:240826333-240826355 TCCAGCCAAGGGGCAGCCCAGGG + Intergenic
1170889313 20:20365172-20365194 AGCACCCAAGGGGCCTTCCCCGG - Intergenic
1173626490 20:44476469-44476491 TTCGCCCAAGGGGGCACACCCGG - Intronic
1175465989 20:59191645-59191667 TTCCTCCAGGAGGCCGCCCCCGG - Exonic
950664515 3:14487146-14487168 TTCACCCAGGGAGCCCCCGCTGG - Exonic
950674165 3:14544688-14544710 TCCACCCCAGGGGCCGGGCCAGG + Intergenic
954993388 3:54860349-54860371 TTCTCCCAAAGGGCCTCTCCTGG + Intronic
955325927 3:58009207-58009229 CTGACCCTAGGGCCCGCCCCCGG - Intronic
963788631 3:149560362-149560384 GTCTCCCAAGGGGCAGCCCTAGG + Intronic
980311554 4:131136948-131136970 CTCACCCAATGGGCCCACCCAGG + Intergenic
983935461 4:173500035-173500057 TTCACCCAAGTGCCTGCCACCGG + Intergenic
985722658 5:1497866-1497888 GTCAGCCAAGGGGCAGCCCCTGG + Intronic
997444814 5:133933366-133933388 TTTCCCCATGGGGCTGCCCCAGG + Intergenic
1002566916 5:180117267-180117289 TCCACCCAAGGGGCAGACACCGG - Intronic
1005740436 6:28785977-28785999 TTCAGCCACGGTGCCGGCCCAGG - Intergenic
1006791263 6:36702799-36702821 CTCACCCCAGGGGCCTCACCTGG + Intronic
1018376741 6:163219905-163219927 TTCCCCAAAGAGGCCTCCCCTGG + Intronic
1026440986 7:70444014-70444036 TTCACCCAAGGGGAAGCAGCAGG - Intronic
1035277696 7:157757979-157758001 ATCATCCACGGGGCAGCCCCAGG + Intronic
1044873929 8:96645589-96645611 GTCACCGAAGGGGCAGCCACAGG - Intronic
1060342946 9:122792915-122792937 TTCACCCAATAGGCTGCCCATGG + Intergenic
1060748931 9:126156119-126156141 TTCACCCGATGGGCTGCCCTGGG - Intergenic
1061111295 9:128573315-128573337 TTCACCCAAGTGGCAGCCACAGG - Intronic
1062360533 9:136185916-136185938 TCCACCCCAGGAGCCGCCCTGGG - Intergenic
1062365328 9:136205479-136205501 ATCACGCATGGGGCTGCCCCGGG - Intergenic
1192052523 X:67738867-67738889 TTCACCCAAGGGCCAACTCCTGG - Intergenic
1194387447 X:93273679-93273701 TTCTCCTAAGAGGCCGCCCATGG + Intergenic
1201511374 Y:14768266-14768288 TTCAGCCCAGGGGCAGCCCTAGG - Intronic