ID: 1161483751

View in Genome Browser
Species Human (GRCh38)
Location 19:4523875-4523897
Sequence GGCCGCGCTGGCCGAGGGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 409}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161483751_1161483762 14 Left 1161483751 19:4523875-4523897 CCCGGCCCTCGGCCAGCGCGGCC 0: 1
1: 0
2: 5
3: 46
4: 409
Right 1161483762 19:4523912-4523934 GAAGCAGCGGGCATCAGCGAAGG 0: 1
1: 0
2: 1
3: 8
4: 108
1161483751_1161483763 17 Left 1161483751 19:4523875-4523897 CCCGGCCCTCGGCCAGCGCGGCC 0: 1
1: 0
2: 5
3: 46
4: 409
Right 1161483763 19:4523915-4523937 GCAGCGGGCATCAGCGAAGGCGG 0: 1
1: 0
2: 0
3: 13
4: 107
1161483751_1161483758 1 Left 1161483751 19:4523875-4523897 CCCGGCCCTCGGCCAGCGCGGCC 0: 1
1: 0
2: 5
3: 46
4: 409
Right 1161483758 19:4523899-4523921 CTGGCACGTCCCTGAAGCAGCGG 0: 1
1: 0
2: 1
3: 20
4: 159
1161483751_1161483759 2 Left 1161483751 19:4523875-4523897 CCCGGCCCTCGGCCAGCGCGGCC 0: 1
1: 0
2: 5
3: 46
4: 409
Right 1161483759 19:4523900-4523922 TGGCACGTCCCTGAAGCAGCGGG 0: 1
1: 0
2: 1
3: 14
4: 144
1161483751_1161483765 26 Left 1161483751 19:4523875-4523897 CCCGGCCCTCGGCCAGCGCGGCC 0: 1
1: 0
2: 5
3: 46
4: 409
Right 1161483765 19:4523924-4523946 ATCAGCGAAGGCGGTCTGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 53
1161483751_1161483764 25 Left 1161483751 19:4523875-4523897 CCCGGCCCTCGGCCAGCGCGGCC 0: 1
1: 0
2: 5
3: 46
4: 409
Right 1161483764 19:4523923-4523945 CATCAGCGAAGGCGGTCTGCAGG 0: 1
1: 0
2: 0
3: 4
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161483751 Original CRISPR GGCCGCGCTGGCCGAGGGCC GGG (reversed) Exonic
900096717 1:942803-942825 GGCCGCGCTGAGGCAGGGCCGGG - Exonic
900379186 1:2375412-2375434 GACAGCGAGGGCCGAGGGCCAGG + Intronic
900579678 1:3402885-3402907 GGCTGCGCTCTACGAGGGCCTGG + Exonic
901069727 1:6511201-6511223 GGACGGGCTGGCCAGGGGCCAGG - Intronic
901489386 1:9588969-9588991 GGCCGGCCTGGCCGGCGGCCTGG + Exonic
901604738 1:10450261-10450283 GGCAGCGGTGGCCGTGGCCCCGG - Exonic
901641448 1:10694968-10694990 GGCCGCGCGGGTCGTGGGGCAGG - Intronic
901672584 1:10864881-10864903 GGCAGCTCTGGCTGAGGGCTGGG - Intergenic
901703986 1:11059956-11059978 GGCGGCGCGGGGCGCGGGCCCGG + Exonic
901871696 1:12142336-12142358 GGCTGAGCTGCCGGAGGGCCGGG + Exonic
901875923 1:12167112-12167134 GGCCGCGCTGGCCGTCGGACTGG + Exonic
902872710 1:19324190-19324212 GGACGTGCGGGCCGAAGGCCTGG - Intronic
903063807 1:20687325-20687347 GGCAGAGCTTGCCCAGGGCCCGG - Intronic
903324701 1:22563347-22563369 GGCGGCGGTGGCCGCGGGCCGGG + Intergenic
903925222 1:26826901-26826923 GGCGGCGCGGGCCCGGGGCCCGG - Exonic
904037891 1:27568595-27568617 GGCCGCGCGGGCCGGGCTCCCGG + Intronic
904039509 1:27575845-27575867 GGCCTGGCGGGCCGGGGGCCAGG - Intronic
904259947 1:29282769-29282791 GGCGGCGCTGGCCCGAGGCCTGG + Exonic
905416482 1:37807997-37808019 GGCCGTGCAGGCCGCGAGCCCGG - Exonic
905449373 1:38046907-38046929 GGGCGCGCGGGGCGGGGGCCGGG - Intergenic
905617254 1:39409433-39409455 TGCCGCGCGCCCCGAGGGCCAGG - Intronic
906047916 1:42846825-42846847 GGCTGCGTGGGCCGGGGGCCAGG - Intronic
906117717 1:43367227-43367249 GGCCGAGCTGCGTGAGGGCCGGG - Intronic
906204410 1:43979378-43979400 GGCCGCGGTGGCCGCTGACCGGG + Intronic
907185012 1:52602678-52602700 GGCCGAGCGGGGCGGGGGCCGGG - Intronic
908951401 1:69567468-69567490 CGCCGCGCTGCCCGAGCGCCCGG + Intergenic
909643186 1:77888928-77888950 GTCCGCGCTGGCCCCGGCCCGGG + Intronic
911208676 1:95117726-95117748 GGCCGCGCTAGGCCAGGGGCGGG - Intronic
912776458 1:112509016-112509038 GGGCGCGCTGCCTGAGGACCGGG - Exonic
913131092 1:115838881-115838903 AGCCGCGGCGCCCGAGGGCCTGG + Exonic
914674832 1:149900329-149900351 CGCAGCGCTGGCCGAGGAGCTGG + Exonic
915469053 1:156114884-156114906 GGCAGCGCTGCCCGCGGGGCAGG - Exonic
916715309 1:167442621-167442643 GGCAGGGCTGGCCCAGGGGCAGG - Intronic
920002334 1:202808259-202808281 GGCAGCGCCGGGCGCGGGCCTGG + Exonic
921017629 1:211207149-211207171 GGCCGCGCTGGGCCGGGGCTCGG - Intergenic
921155074 1:212432982-212433004 GGCAGCGCTGGCCCTGGTCCTGG + Exonic
921671110 1:217925066-217925088 GGCCGAGCGCGCCCAGGGCCTGG - Intergenic
922440532 1:225652658-225652680 GGGCGCGCGGGGCGGGGGCCGGG - Intronic
922619633 1:226981824-226981846 GGAGGCGCTGGCGTAGGGCCTGG + Intronic
922696960 1:227735635-227735657 GGCTGCGCTGGGAGAGGGGCGGG + Intronic
923055918 1:230425983-230426005 CGCGGCGCGGGCCCAGGGCCCGG - Intergenic
923461681 1:234214404-234214426 GGCCGCGTCGGCCACGGGCCCGG + Intronic
924042485 1:239997717-239997739 GGCCGGGCTCGGCGCGGGCCGGG - Intergenic
1062774553 10:135037-135059 GGGCGGGCGGGCCGAGGGGCCGG + Intronic
1065186516 10:23174571-23174593 GGCCGGGCTGGGGGAGGGCAGGG + Intergenic
1067205348 10:44207784-44207806 GGCTGCTGTGGCCAAGGGCCAGG - Intergenic
1069688699 10:70335469-70335491 GGCTGCCCTGGCCCAGGCCCAGG + Intronic
1070660646 10:78303211-78303233 GGCCGCGCGGGCCGAGGGGCGGG - Intergenic
1071291927 10:84194830-84194852 GGCCGCGCTGGCCGCGTGGATGG + Intronic
1072190521 10:93073600-93073622 GGCGGCGGTGGGGGAGGGCCAGG - Intronic
1072782098 10:98258116-98258138 GGCCCAGGTGGGCGAGGGCCGGG - Exonic
1074055972 10:109923253-109923275 GGCCGCGCTCGCCGGAGCCCCGG - Intronic
1075748421 10:124743966-124743988 GGCGGCGGTGGCCGGGGGGCTGG - Intronic
1076096344 10:127737240-127737262 GGCACCGCTGGCCCAGGCCCGGG + Exonic
1076370072 10:129946953-129946975 GGCCTCGCTGGCCGGGGACCTGG + Intronic
1076374267 10:129972948-129972970 GGCGGCGCCGGCTGCGGGCCGGG + Intergenic
1076379913 10:130017796-130017818 GGCCAAGCTGGCTGAGAGCCGGG - Intergenic
1076878904 10:133230585-133230607 GGCCGCGCTGGCCCAGCAGCAGG + Exonic
1077053152 11:576701-576723 CGCCGCGCTGGCCGCGGGCCGGG + Intronic
1077214675 11:1390411-1390433 GGCCGCGCTGGCAGCGCGCTGGG + Intronic
1077225937 11:1439196-1439218 GGGTGAGCTGGCTGAGGGCCTGG + Intronic
1077253813 11:1571962-1571984 GGCCGCGCCGTCCATGGGCCCGG + Intergenic
1077342388 11:2031912-2031934 GGCCGGGCAGGCAGAGGGGCAGG - Intergenic
1077404583 11:2377436-2377458 GGCCTGGCGGGCCGAGGGGCGGG - Exonic
1077919813 11:6633611-6633633 GGCCCGTCTGGCCAAGGGCCAGG + Exonic
1079361947 11:19777106-19777128 GGCCGCGGCGGCCGAGGGCGGGG - Intronic
1081873000 11:46391694-46391716 GGGCGGCCGGGCCGAGGGCCGGG + Intergenic
1083748108 11:64746142-64746164 AGCCTCGCTGGCCGGGGGCGGGG - Intergenic
1084046123 11:66568544-66568566 GGCCCCGCTGGCCGCGGGCTCGG - Exonic
1084086872 11:66858895-66858917 GGCGGCGATGTCCGAGGGCCCGG - Exonic
1084129159 11:67119698-67119720 GCCCCTGCTGGCCGAGGGCACGG + Exonic
1084175591 11:67420755-67420777 GGCCGCGCTGGCCGCCGTGCTGG + Exonic
1084636907 11:70398784-70398806 GGCGGGGCAGGGCGAGGGCCGGG + Intronic
1084860443 11:72014526-72014548 GGCCGCGCTGATGGAGAGCCAGG - Exonic
1085205814 11:74731325-74731347 GGCCGCGGGGGCCTGGGGCCCGG + Intronic
1085413890 11:76307598-76307620 GGCTGCAGTGGCCCAGGGCCTGG - Intergenic
1085463803 11:76710771-76710793 GGCCACGTTGGCCAAGGGGCTGG + Intergenic
1085472722 11:76768485-76768507 GGCCGGGCTGGCTGGGGGCAGGG - Intergenic
1087936163 11:104036784-104036806 GGCCGGGCTAGCAGAGGGCATGG - Exonic
1089537403 11:119169087-119169109 GGCCGCGCTGAGCGGGGGGCAGG + Exonic
1090333449 11:125948026-125948048 GGCTGTGCTGGGTGAGGGCCTGG + Intergenic
1091263636 11:134253660-134253682 GGCCGGTCTGGACGAGGACCCGG - Exonic
1202825374 11_KI270721v1_random:87101-87123 GGCCGGGCAGGCAGAGGGGCAGG - Intergenic
1091391049 12:126128-126150 GGACGTGCTGCCCAAGGGCCTGG - Intronic
1091712593 12:2752614-2752636 GGACGCCCTTGCCGAGGGCGCGG + Intergenic
1092256226 12:6928046-6928068 GGCCGGGCGGGCCGCGGGGCCGG + Intronic
1093741390 12:22693315-22693337 GGCGGCGCTGGCCGGCGGCTCGG + Intergenic
1095465107 12:42482278-42482300 CGCCGCGCTGGCGGAGGACCAGG - Intronic
1095773634 12:45990084-45990106 GGCGGCGGCGGCCCAGGGCCGGG + Intronic
1095949273 12:47773163-47773185 GGCGGCGCTGGGGGCGGGCCGGG + Intronic
1096177835 12:49534832-49534854 GGCCTTGCTGGCTGAGAGCCAGG + Intergenic
1096260228 12:50085566-50085588 GGGCGCGCGGGCCGGGGGCGGGG + Intronic
1096647985 12:53048526-53048548 GCCCACACTGGCCGGGGGCCTGG + Intronic
1096783878 12:54006224-54006246 GGCCGGGCCGGCCGAGGCGCGGG - Intronic
1097058793 12:56267221-56267243 CGCGGCGGTGGCAGAGGGCCTGG - Exonic
1101037225 12:100717477-100717499 GGCCGCTCTAGCCGACGCCCTGG + Intergenic
1101244971 12:102876692-102876714 GGCTGCGGTGGCTCAGGGCCAGG - Intronic
1101466897 12:104958293-104958315 GGCCGCGGGCGCCGACGGCCGGG - Intronic
1101605893 12:106247647-106247669 GGCCGCCCTTGCCGTGCGCCTGG + Exonic
1101844208 12:108349532-108349554 GGGGGCGCTGGCCCTGGGCCTGG + Intergenic
1103613617 12:122138724-122138746 GGCAGGGCTGGCCCAGTGCCGGG - Intronic
1103659235 12:122500550-122500572 GGCAGCGCCGGGCGAGGGCGAGG - Exonic
1103758915 12:123233667-123233689 GGCCGCGCTGGCGGTGGGGTGGG + Intronic
1104127537 12:125861881-125861903 GGCCGAGGTGGCCGCGGGGCGGG + Intergenic
1104640657 12:130464878-130464900 GGCCGAGCAGGCCCAGCGCCTGG + Intronic
1104820899 12:131677126-131677148 GGCCTCGGTGGCAGAGGCCCAGG + Intergenic
1104836833 12:131797273-131797295 GGCCGCGGGGGCCGCGGGCCGGG - Exonic
1104858778 12:131914099-131914121 GGCCACCCTGGCCGGGGCCCTGG - Intronic
1104903633 12:132202217-132202239 GGCCTCACTGCCCGGGGGCCTGG + Intronic
1104957663 12:132474366-132474388 GGCCGCCCAGGCCTGGGGCCTGG - Intergenic
1104966378 12:132510344-132510366 GGCAGGGATGGCCCAGGGCCAGG - Intronic
1105014338 12:132777026-132777048 AGCAGAGCTGGCCGAGGCCCGGG - Exonic
1105019629 12:132807730-132807752 GGCAGGGCAGGCAGAGGGCCTGG - Intronic
1105975457 13:25468749-25468771 GGCCGCGCGGGGCGTGGGCGTGG + Intronic
1112656130 13:101453961-101453983 GGCCGCGCTGTGCCACGGCCGGG + Exonic
1113537468 13:111079576-111079598 AGCCGCGCAGGCCGGGGGACTGG - Intergenic
1113541872 13:111115447-111115469 GGCGGCGGGGGCCGCGGGCCGGG + Exonic
1113654887 13:112061769-112061791 GGCCGGGCAGGCCGAGCGGCAGG + Intergenic
1113768432 13:112894579-112894601 GGCCGCCCTGACCGCGAGCCGGG - Intronic
1119492773 14:75051149-75051171 GGCCGCGCGGGCCGAGTCCGGGG + Intronic
1119569752 14:75660302-75660324 GGCTGGGCTGGGCCAGGGCCAGG - Intronic
1121456984 14:94044554-94044576 GGCCTCCCTAGCTGAGGGCCGGG + Intronic
1122125238 14:99575206-99575228 CCCTGCGCTGGCTGAGGGCCAGG - Intronic
1122143349 14:99675186-99675208 GGCCGCGCTGGCCGCGGGGTTGG - Exonic
1122274937 14:100586621-100586643 AGCCGCTCTGGGCGAGGCCCTGG + Intronic
1122771439 14:104099654-104099676 GGCCATGCTGGCCGTGGACCTGG - Intronic
1122904323 14:104795115-104795137 TGCCTCGCTGGCCCAGCGCCCGG + Intronic
1122974710 14:105166341-105166363 GGCCACGCTGGCTCAGGCCCAGG + Intronic
1122982182 14:105196840-105196862 GGCCGCACCTGCCGAGGCCCAGG - Intergenic
1123021623 14:105400466-105400488 GGCCGCTCAGGAGGAGGGCCAGG + Intronic
1124251890 15:28112307-28112329 GGCCTGGCTGGCGGAGGACCAGG + Intronic
1124606815 15:31175665-31175687 GGGCTCGCTGGCTGGGGGCCAGG - Intergenic
1125508792 15:40282044-40282066 GGCGGCGCGGCCCCAGGGCCCGG + Exonic
1125675937 15:41502649-41502671 GGCCACGCTGGGCGGGGCCCTGG + Intronic
1125937515 15:43649313-43649335 GGCCGGGCTGGGCCGGGGCCGGG + Intronic
1126099751 15:45112001-45112023 GGCCGCCCTGGCCGTGGGGAGGG - Intronic
1126846198 15:52762602-52762624 GGACGCCCTGGCCTAGGGCCTGG + Intronic
1129823700 15:78620802-78620824 GGCCGGGCTGGCCGCGGACCCGG + Exonic
1130314916 15:82786994-82787016 GGCAGCGGAGGCCGAGGACCTGG - Exonic
1132319837 15:100918103-100918125 GGGAGCGCAGGCCCAGGGCCCGG - Intergenic
1132519781 16:381846-381868 GGCGGCGCGGGACGCGGGCCGGG - Exonic
1132589998 16:722401-722423 GACCGCGGTTGGCGAGGGCCTGG + Exonic
1132616177 16:842132-842154 GGCAGCGCTACCCGAGGCCCAGG - Intergenic
1132656218 16:1043041-1043063 GGCTCTGCTGGCCGAGGGGCGGG - Intergenic
1132674974 16:1117724-1117746 GGCCTCGGTGGTCCAGGGCCAGG - Intergenic
1132865204 16:2089827-2089849 GGCAGTGCTGGCCGCAGGCCCGG + Exonic
1132889480 16:2196742-2196764 GCCCGCGCCGGCCGCGCGCCCGG + Intergenic
1132996836 16:2827875-2827897 AGCTGTGCTGGCCGAGGGCTTGG + Intergenic
1133045109 16:3083596-3083618 GGCAGAGCTGCCCGAGGCCCTGG - Intergenic
1133275233 16:4634273-4634295 GGCTGGGCTGGGCGAGGGCCAGG - Intronic
1134245141 16:12534138-12534160 GGCCGCGCTGCCCTGAGGCCTGG - Intronic
1134539940 16:15056046-15056068 GGACGCGCGGCCCGAGGGGCGGG - Exonic
1136576310 16:31127372-31127394 GGCCGAGCTGGGCAGGGGCCCGG + Intronic
1136621020 16:31428278-31428300 GGCAGCGCTGGCCAAGCCCCGGG + Exonic
1137596561 16:49727817-49727839 GGCCGCGCTGGGCGCAGGCTGGG - Intronic
1137701557 16:50501509-50501531 GGCAGCGCTGGCCCAGTGCTGGG + Intergenic
1137926596 16:52546972-52546994 GGCAGCGCTGCGCGCGGGCCGGG + Exonic
1138016690 16:53434736-53434758 GGCGGCGCGGGCCGAGGCCTGGG + Exonic
1138327852 16:56191007-56191029 GGCCGCGCTGGCAGCGAGCTGGG + Intergenic
1138344579 16:56312065-56312087 GGCAGAGCTGGCCCAGAGCCCGG - Intronic
1138471964 16:57245154-57245176 GGCGGCGCGCGCAGAGGGCCAGG + Exonic
1139390796 16:66605351-66605373 GGCCCCGCAGGTCGAGGCCCCGG - Intronic
1139481728 16:67234405-67234427 GGTTGCGCTGGCCCAGGGCCGGG - Exonic
1139549553 16:67666131-67666153 CGCCGCGCTGGCCGCGCTCCAGG + Exonic
1139866460 16:70065871-70065893 CGCCCCGCTGGCCGCGGGCGCGG - Intergenic
1140528999 16:75648086-75648108 GGAGGCGCTGGCCGAGGCCTCGG + Exonic
1140927616 16:79599282-79599304 GGCCGCGCTGCCCGCGGCGCCGG + Exonic
1141592811 16:85079877-85079899 GGCCGCCCTGGCATATGGCCTGG + Intronic
1141682619 16:85553371-85553393 GGCCGCCGGCGCCGAGGGCCTGG + Intergenic
1141841455 16:86576730-86576752 GGCCGCGCCCGCCTAGGTCCTGG - Intronic
1141955092 16:87365481-87365503 GGCCGCTCTGGGCGTGGTCCAGG + Intronic
1142136335 16:88453518-88453540 GGCCGCGGAGACCGGGGGCCGGG + Exonic
1142210313 16:88805470-88805492 GGCCGGGCTGGGCCAGGGCATGG - Exonic
1142253613 16:89003417-89003439 GGCCGAGCTGACCCGGGGCCTGG - Intergenic
1142310172 16:89307633-89307655 GGGCACCCAGGCCGAGGGCCGGG - Intronic
1142335822 16:89489665-89489687 GGGGGCGCTGGCCGGGCGCCGGG - Intronic
1142373947 16:89697322-89697344 GGCCCAGCTGGCCTAGGGCCGGG + Exonic
1142378861 16:89720881-89720903 GGCGGCGGTAGCCGAGGGGCTGG + Exonic
1142762397 17:2050178-2050200 GGCGGCGCAGGCAGCGGGCCGGG + Intergenic
1143025196 17:3937483-3937505 GGCTGCGGTGGAGGAGGGCCGGG - Exonic
1143034984 17:3989610-3989632 GGCCCTGCAGGCCGAGGCCCCGG - Intergenic
1143578216 17:7807550-7807572 AGCCGCGCTCGCTGAGGCCCAGG + Exonic
1143747190 17:9003307-9003329 GGCGGGGGTGGCCGCGGGCCGGG + Intergenic
1144682746 17:17206238-17206260 GGCCGCGGCGGCTGTGGGCCTGG - Exonic
1144756441 17:17682697-17682719 GGCCGCGACGGCCTAGGGCCTGG - Intronic
1144968658 17:19093601-19093623 GGCCGAGGTGTCCGAGGCCCAGG - Exonic
1144979257 17:19158465-19158487 GGCCGAGGTGTCCGAGGCCCAGG + Exonic
1144988965 17:19219767-19219789 GGCCGAGGTGTCCGAGGCCCAGG - Exonic
1145214724 17:21042922-21042944 GGCCAGGCTGGCCAAGGCCCGGG + Exonic
1146058584 17:29593171-29593193 GGCCGCTCGGGCTGAGGGCCGGG + Intronic
1147123773 17:38352152-38352174 GGGGGCGGTGGCGGAGGGCCTGG - Intergenic
1147313048 17:39606377-39606399 GGCCACGTTGGCCGAGGTCAAGG - Exonic
1147425813 17:40345405-40345427 GGAGCCGCTGGCCGGGGGCCCGG + Intronic
1147555700 17:41477627-41477649 GGCCCAGCTGGCCGAGATCCGGG - Exonic
1147671860 17:42181008-42181030 GGGCGCGCTGTCGGAGGGGCCGG + Exonic
1147786021 17:42979522-42979544 GGCCCTGCCGTCCGAGGGCCTGG - Intronic
1147983303 17:44288576-44288598 GGCCACCCTGGAGGAGGGCCAGG - Intergenic
1148438427 17:47699387-47699409 GGCCGCGCAGGGAGAGGCCCGGG + Exonic
1148493435 17:48037705-48037727 GGCGGCCCAGGCCGGGGGCCCGG - Exonic
1148503236 17:48107626-48107648 GGCTCCGCTGGCCAAGGCCCCGG - Exonic
1148807840 17:50273238-50273260 GGGGGCGCTGGGCGAGGGCGAGG - Intronic
1149991417 17:61385620-61385642 GCCCGCGCTTGCCCAGTGCCTGG - Intronic
1150069247 17:62138151-62138173 GGCCGCGCGGGCCGAGCGGGCGG + Intergenic
1151419528 17:73988050-73988072 GTCCGTGCTGGCAGAAGGCCTGG + Intergenic
1152321278 17:79609979-79610001 GGCCGCGCTGCTCGAGGCCCTGG + Intergenic
1152338899 17:79713655-79713677 GGCCGCGCTGGGCTAAAGCCAGG - Intergenic
1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG + Intronic
1152568728 17:81111934-81111956 GGCCTGGCTGCCCGTGGGCCAGG - Intronic
1152683860 17:81684154-81684176 GGCCGCGCTGACTCAGCGCCGGG - Intronic
1152763405 17:82121705-82121727 GGACGCGCTGACTGAGGCCCAGG - Intronic
1152834355 17:82519825-82519847 GGTGGCGCGGGCCGAGGCCCAGG - Exonic
1153900658 18:9614617-9614639 CGCGGGGCGGGCCGAGGGCCCGG + Intronic
1154210692 18:12376839-12376861 GGCCGTCCCTGCCGAGGGCCTGG - Intronic
1156183442 18:34633551-34633573 GGTCGGGATGGCAGAGGGCCAGG + Intronic
1157384312 18:47248361-47248383 GGCCGCGGTGGCCGGAGGCGGGG - Intronic
1157550201 18:48576071-48576093 GGCGCCGCTGCCCGAGGACCGGG - Intronic
1160431135 18:78813359-78813381 GGCCACGCTGGCCCAGGGGTCGG - Intergenic
1160449585 18:78953125-78953147 GGCAGCGCTGTCCGAGTGCTGGG - Intergenic
1160491128 18:79337329-79337351 GGCCGCGGTAGTCGAGAGCCTGG + Exonic
1160677437 19:398951-398973 GGCCGGGCTGGTCGAGGCTCTGG - Intergenic
1160810077 19:1009464-1009486 GGCCGCGCCGCACCAGGGCCTGG - Exonic
1160831939 19:1108309-1108331 GGGCGCGCTGGGGGAGGGCGCGG - Exonic
1160835532 19:1122936-1122958 GGCCCCGCTGTCCGAGGGCAGGG + Exonic
1160853424 19:1205656-1205678 GGCGGGGCGGGCAGAGGGCCGGG + Intronic
1160908995 19:1466228-1466250 GGCCTCGCGGGCCGGGGGCTCGG - Exonic
1161301800 19:3546356-3546378 GGTGGCGCTGGCGGAGGGACTGG - Exonic
1161483751 19:4523875-4523897 GGCCGCGCTGGCCGAGGGCCGGG - Exonic
1161950174 19:7463512-7463534 GGCCGCCCTGGGCCAGGGGCTGG - Intronic
1162031165 19:7917816-7917838 CGCCGCGCTGGCCGCCGGGCTGG + Exonic
1162100196 19:8334572-8334594 GGCCGCGCAGACCGAGTCCCCGG - Exonic
1162479647 19:10920985-10921007 GGCCGCCCTCGCCGCAGGCCTGG + Intronic
1162909843 19:13842828-13842850 GGCCGGGCCGGCCGAGGCTCAGG + Intergenic
1163020460 19:14478505-14478527 GGATGAGCTGGCCGAGGCCCTGG - Exonic
1163427240 19:17246153-17246175 GCCCGAGCTGGGCGAGGGCGAGG - Intronic
1164394383 19:27850772-27850794 GGCCGCGTGGGCCCAGGGGCGGG + Intergenic
1164722789 19:30444537-30444559 GGCCGAGTCGGCCCAGGGCCAGG + Exonic
1165349356 19:35267988-35268010 GGCCGCGCGGGGCGGGGGACCGG + Intergenic
1165350465 19:35272468-35272490 GGCGGCCCTGGCTCAGGGCCTGG - Intronic
1165658167 19:37551234-37551256 GGCCGTGCTGGCTGCGGCCCGGG - Intergenic
1165738773 19:38193615-38193637 AGCCCCGCTGGCCTAGAGCCAGG + Exonic
1166107022 19:40602494-40602516 GGCTGGGCTGGCTGGGGGCCAGG - Intronic
1167110355 19:47457114-47457136 GGCGGCGCCGGCCGAGGGCGCGG - Exonic
1167284100 19:48589123-48589145 GGCGGCGCTGGCCGGGGTCCAGG + Intronic
1167548577 19:50144026-50144048 GACCTTGATGGCCGAGGGCCAGG - Intergenic
1167569119 19:50276048-50276070 AGCAGCCCTGGCCGAGGCCCAGG + Exonic
1167708971 19:51098684-51098706 GGCGGCCCTTGCCGATGGCCAGG + Exonic
1167781467 19:51601604-51601626 GGCGGCCCTTGCCGATGGCCAGG - Intergenic
925025800 2:606200-606222 GGCTGCGCTGGGCGTGGGCTGGG + Intergenic
925060257 2:885409-885431 GGCAGGGCTGACCGTGGGCCTGG - Intergenic
927208237 2:20623462-20623484 GGCCTCTCTGCCGGAGGGCCCGG - Intronic
927714286 2:25342112-25342134 GGCCGCGCTGGCCCCGGCCCCGG + Intronic
927894998 2:26775867-26775889 GGCCGGGCAGGGCGAGGGGCTGG + Intronic
929604259 2:43224868-43224890 GGCCGCGGAGGCCGAGGAACAGG + Exonic
930029623 2:47050129-47050151 GGCCCGGCTGGGAGAGGGCCCGG - Intronic
930774706 2:55160545-55160567 TGCTGCACTGGCCCAGGGCCTGG - Intergenic
930872690 2:56184409-56184431 GCCCGCGCTCCCCCAGGGCCCGG - Exonic
931461932 2:62457150-62457172 GGCTGGGCTGGCCGAGAGCCGGG + Intergenic
931968631 2:67561494-67561516 GGCCGGGCTGGCCCAGTGCCTGG - Intergenic
932567688 2:72919982-72920004 GGCCGCCGCGGCCGAGGGGCTGG + Intronic
933691131 2:85180430-85180452 GGCTGCGATGGCTGAGGGTCAGG - Intronic
935677663 2:105609711-105609733 GGCCACGCTGCCCCAGGGGCTGG + Intergenic
935709157 2:105881916-105881938 GCGCCCGCTGGACGAGGGCCCGG - Exonic
937120468 2:119437110-119437132 GCCCGGGCTGGCCGTGGGCATGG + Exonic
938074029 2:128322527-128322549 GACCGCGCTGGAAGAGGCCCGGG + Intergenic
938795950 2:134718641-134718663 GGCCGCGCTGGGCGAGGCGCGGG - Intronic
939613022 2:144332551-144332573 GGCCGAGGCGGCCGCGGGCCGGG - Intronic
940035715 2:149310474-149310496 GGCAGCGCAGGCCCAGAGCCAGG + Intergenic
941111704 2:161423924-161423946 GGGCGAGGAGGCCGAGGGCCTGG + Exonic
941221565 2:162787662-162787684 GGCCGGGCTGGTCCTGGGCCAGG - Intronic
941384818 2:164840965-164840987 GGCCGCCCGGGCGGAGGGCTCGG - Intronic
941808644 2:169734225-169734247 GGCCGCGCGGGCGCCGGGCCGGG + Intronic
945234365 2:207621005-207621027 GGCAGGGCTGGACCAGGGCCTGG - Intronic
946003071 2:216499084-216499106 GGCCGCGCGCTCCGAAGGCCCGG - Intronic
946360914 2:219218904-219218926 GGCCCCGCTGGCTCTGGGCCCGG + Exonic
946418687 2:219552964-219552986 GGCGGCGCGTGCCGAGGGCCTGG + Exonic
947435460 2:230068520-230068542 GGCCGCGCGCGCCGCGGGCCTGG - Intronic
948140484 2:235669524-235669546 AGCCGGGCTGGCCGAGTCCCGGG - Intronic
948140600 2:235669908-235669930 CGCCGCGCCGCCCGAGTGCCGGG - Intronic
948560133 2:238846958-238846980 GGCCGCTCTGGCTCTGGGCCTGG - Intergenic
948857535 2:240736990-240737012 TGCCGGGTTGGCTGAGGGCCTGG + Intronic
948891584 2:240909390-240909412 GGCAGAGCTGGCCGAGCTCCAGG - Intergenic
949004225 2:241636590-241636612 GACCGCGCGGGCCGTCGGCCTGG - Intronic
949040796 2:241849269-241849291 GGCTGCGGTGCCCGAGGGCCTGG + Intergenic
949041577 2:241852164-241852186 GGCAGGGCAGGCCGAGGGGCTGG + Intronic
1171200334 20:23235553-23235575 TGCTGTGCTGGCCCAGGGCCGGG - Intergenic
1172978878 20:38926445-38926467 GGCTCTGCTGTCCGAGGGCCTGG + Exonic
1173250404 20:41361438-41361460 GGGCCTGCTGGCCGCGGGCCTGG - Exonic
1174317470 20:49713778-49713800 GGAGGCGGTGGCCGAGGCCCAGG - Exonic
1175428785 20:58888950-58888972 GGCCGCGATGGCGGGGGGCGCGG - Intronic
1176548974 21:8213451-8213473 GGCCGGGCGGGCCGCGGGGCGGG - Intergenic
1176556867 21:8257663-8257685 GGCCGGGCGGGCCGCGGGGCGGG - Intergenic
1176567903 21:8396481-8396503 GGCCGGGCGGGCCGCGGGGCGGG - Intergenic
1176575807 21:8440700-8440722 GGCCGGGCGGGCCGCGGGGCGGG - Intergenic
1178327849 21:31659938-31659960 GGCCGCCCTGGTCCAGCGCCCGG + Intronic
1178494107 21:33072143-33072165 GGCCGCGCTGGTCAAGGGCCCGG - Exonic
1179419838 21:41226733-41226755 GGCCACTCTGGCCGAGGGTGTGG + Intronic
1179506654 21:41845526-41845548 GGCCGGGCTGCCCGAGTACCTGG + Intronic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1181041310 22:20193962-20193984 GGCCGGGCAGCCTGAGGGCCAGG + Intergenic
1181119285 22:20654780-20654802 GGCCGCTCAGGCCCAGGCCCTGG - Intergenic
1181283376 22:21735658-21735680 GCCCGCGCTGACCGGGGCCCGGG - Exonic
1181532113 22:23522716-23522738 GGCCGCGGAGGGCGGGGGCCGGG + Intergenic
1182236917 22:28883511-28883533 GGCTGCGGAGGCCGAGGGCGGGG + Intergenic
1183299913 22:37053772-37053794 GGCCTAGGTGGCCGAGGCCCTGG + Intronic
1183329536 22:37211982-37212004 GACAGCCGTGGCCGAGGGCCTGG - Exonic
1183379061 22:37481701-37481723 GGCCGGGCAGTCCCAGGGCCGGG - Intronic
1183540518 22:38426929-38426951 GGCCGCGGTGGCCGCAGGCCTGG - Exonic
1183743149 22:39679359-39679381 GGCGCCCCTGGCCGAGGGCCGGG + Exonic
1183744826 22:39686234-39686256 CGCCGCCCTGGCCCACGGCCTGG + Exonic
1184089230 22:42283681-42283703 GGCCGCGCCGGGCCAGGGCAGGG - Intronic
1184186996 22:42871581-42871603 TGGCGGGCAGGCCGAGGGCCTGG + Intronic
1184380260 22:44140917-44140939 GGCTGGCCAGGCCGAGGGCCGGG - Intronic
1185081891 22:48714062-48714084 GGCCGCCCTGGGCGAGGGCCTGG - Intronic
1185234856 22:49705811-49705833 GGCCGCTCTGCCCGAGGGGAGGG + Intergenic
1185259499 22:49853793-49853815 GGCGGGGCTGGCCGGGGGCGGGG - Intergenic
1185277417 22:49955819-49955841 GGCCACCCTGGCCTTGGGCCTGG - Intergenic
1203253858 22_KI270733v1_random:129758-129780 GGCCGGGCGGGCCGCGGGGCGGG - Intergenic
1203261914 22_KI270733v1_random:174837-174859 GGCCGGGCGGGCCGCGGGGCGGG - Intergenic
950021335 3:9789809-9789831 GGCCGTCCTGGGCCAGGGCCCGG + Exonic
950040202 3:9915247-9915269 GGCCGCGCTGGGCCCGGGCCTGG - Exonic
950408089 3:12816960-12816982 GGACGCCCTGGCCCAGAGCCAGG + Exonic
950438468 3:12994114-12994136 GGCCGCGCCGGCCGCGGGGACGG - Intronic
950583907 3:13879827-13879849 GGCCGCCGGGGCCGCGGGCCGGG + Exonic
950684553 3:14607157-14607179 GGGAGCGCTGGCTGGGGGCCTGG - Intergenic
952816637 3:37452607-37452629 GGCGGCGCTGGCCTGGGGGCCGG - Intronic
953638682 3:44685486-44685508 GGCTGCGCTGGCGGCGGGGCCGG - Intergenic
954107526 3:48417453-48417475 AGGCACACTGGCCGAGGGCCAGG - Intronic
954194842 3:48990361-48990383 GGCCGGGCTGGGCGACGGCGAGG + Exonic
954444761 3:50540703-50540725 GCACCTGCTGGCCGAGGGCCTGG + Intergenic
955769213 3:62372418-62372440 GTCCGCGCTGCCCGCGGGCAGGG - Exonic
956061935 3:65356830-65356852 GGACGCGCAGGCCGAGCGCGCGG - Exonic
958933601 3:100233758-100233780 GGTAGCTCTGGCCCAGGGCCTGG - Intergenic
961182395 3:124887072-124887094 GAGCGCGGGGGCCGAGGGCCGGG + Exonic
961827406 3:129606348-129606370 GGCCGAGGCGGCCGTGGGCCCGG - Exonic
966923889 3:184631973-184631995 GGCTGGGCAGGCTGAGGGCCTGG + Intronic
968506449 4:973364-973386 GGCCGCGCGCGCCCGGGGCCGGG - Exonic
968509623 4:989729-989751 CGCCGCCCTGGCCAAGAGCCTGG - Exonic
968602715 4:1517950-1517972 GGCTGGGCAGGACGAGGGCCTGG - Intergenic
968701059 4:2058653-2058675 GGCCGCGGGGGGCGGGGGCCGGG + Intergenic
968775536 4:2537310-2537332 CGCTGCGCTTGCCGAGGTCCCGG + Intronic
968907991 4:3463384-3463406 GGCGGCGCTGGTGGAGGGCCAGG + Exonic
968935248 4:3606942-3606964 GGCCTCACTGGCCTGGGGCCAGG + Intergenic
969297436 4:6278216-6278238 GGCCGAGCTGACTGAGGCCCTGG + Intronic
969594668 4:8142298-8142320 GCCCGCACTGCCCGAGGGCATGG + Intronic
969619000 4:8269662-8269684 GGCGGGGCTGGCGGAGGGGCCGG + Intergenic
969619105 4:8270001-8270023 GGCCGCGCTGGCGCTGGCCCGGG + Exonic
981713592 4:147732163-147732185 TGCCGCGCTCGCCGCGCGCCCGG + Exonic
983941472 4:173538203-173538225 GGCCGCGAGGGCTGAGGCCCTGG - Intergenic
984701250 4:182820000-182820022 GGCCGCACTGTCCGAGTGCCTGG - Intergenic
985643468 5:1074338-1074360 GGCTGTGCTGGCAGAGGGGCCGG + Intronic
987132589 5:14872330-14872352 GGCCGGGCTGGCGGCGGGCGGGG + Intergenic
990557652 5:56951916-56951938 GGCGGGGCTGGCCGGGGGGCGGG - Intronic
992663730 5:78985385-78985407 GGCGGCGGGGGCCGAGCGCCCGG - Exonic
997470503 5:134114675-134114697 GGCGCCGCCGGCCGAGTGCCGGG - Intergenic
997714174 5:136029594-136029616 GGAGTCGCTGGCCGGGGGCCTGG - Intronic
999727195 5:154446528-154446550 GGCCGCGCTTGCCGCGGGGCAGG - Exonic
1001712675 5:173790948-173790970 GGCCACGTGGGCCGAGTGCCCGG - Intergenic
1001959479 5:175871706-175871728 GTCGGTGCTGGCCGAGGGCCGGG + Intronic
1002103811 5:176870096-176870118 GCCCTCGCTGCCCCAGGGCCAGG + Intronic
1002279049 5:178120326-178120348 GGCCTGGCTGGCCCGGGGCCCGG - Exonic
1002539898 5:179899785-179899807 AGCCTCGCTGGCCAGGGGCCTGG - Intronic
1002896198 6:1381964-1381986 GGCCGCGATTCCCGAGAGCCTGG + Intergenic
1002926779 6:1609711-1609733 GGCCGCCCTGGCCCGGGCCCCGG - Intergenic
1003139173 6:3456800-3456822 AGCCGCGGCGGCTGAGGGCCCGG - Intronic
1003551757 6:7107485-7107507 GGCCGGGCTGCCCGAGGGGAAGG - Intergenic
1006078714 6:31551515-31551537 GGCAGGGCTGGCAGAGGACCAGG - Intronic
1006521519 6:34573771-34573793 GGCCTAGCTGGCATAGGGCCAGG + Intergenic
1012399506 6:98832632-98832654 GGCCACTCTGGCCGCGCGCCTGG - Intergenic
1012401204 6:98843871-98843893 GCCCGGGCTGGCCGCGGGGCCGG - Intergenic
1012887177 6:104859528-104859550 GGCCAGGCTGGCCGCGGGGCTGG - Intronic
1013514604 6:110874637-110874659 CGGCTGGCTGGCCGAGGGCCTGG - Intronic
1013619316 6:111873011-111873033 GGCCGCGCCGGAGGAGGGCGGGG - Exonic
1014137732 6:117907906-117907928 GGCGGCGCCGGGCGAGGGCGCGG + Intronic
1014246827 6:119078540-119078562 GGCGGCGGCGGCCGGGGGCCGGG + Exonic
1015773472 6:136792031-136792053 GGCGGCGGTGGGCGAGGGCGAGG - Exonic
1019345813 7:530297-530319 GGCAGCGCCGGGCGAGGGCTTGG - Intergenic
1019515469 7:1438061-1438083 AGTCGGGCTGGCCCAGGGCCAGG + Intronic
1019516015 7:1440558-1440580 GGTGGGGCTGGCCCAGGGCCTGG - Intronic
1019708002 7:2505558-2505580 GGACTCGCTGGCCCAGGGCCTGG + Intergenic
1020009579 7:4800713-4800735 GGCTGGGCTGGGCTAGGGCCTGG - Intronic
1020130174 7:5555217-5555239 GGCCGGGCCGGCCGAGGGGCGGG - Intronic
1020278270 7:6637419-6637441 GGCCGGGCTGGCCGAGCCACGGG - Exonic
1021313161 7:19117096-19117118 TGCCGCGCTTGCCCTGGGCCGGG + Exonic
1022856634 7:34321371-34321393 AGCCGCGCTTTCCCAGGGCCTGG - Intergenic
1023858520 7:44201367-44201389 GGGCGGGGTGGCCGAGTGCCCGG + Intronic
1025196753 7:56940220-56940242 AGCCGGGCTGGCTGAGTGCCAGG - Intergenic
1025615687 7:63114347-63114369 GGCCGCGCACGCCCAGGGGCTGG + Intergenic
1026869586 7:73842236-73842258 GGTCGCGCTGGCAGGAGGCCTGG - Intronic
1026873226 7:73865741-73865763 GACCCAGCTGGCCGAGGCCCAGG + Exonic
1026964614 7:74431247-74431269 GGCCGGGCTGCCCCAGGGCCAGG + Intergenic
1029456201 7:100673771-100673793 GGCAGCGCTGGCGGCGGGGCTGG + Exonic
1029705772 7:102274972-102274994 GTCTGCGCTGTCAGAGGGCCAGG - Intronic
1031482989 7:122300476-122300498 GGCCGCACTGGCCCCGGGCCTGG + Intergenic
1032020715 7:128405977-128405999 GGCCGGGCGGGCCGGGGGCGGGG + Intronic
1033165466 7:139035603-139035625 GTGGGCGCTGGCCGCGGGCCTGG - Intronic
1034188387 7:149196008-149196030 GGCCCCGCGGGGCGGGGGCCGGG + Intronic
1034275265 7:149821239-149821261 GACAGAGCTGGCCCAGGGCCTGG - Intergenic
1034522557 7:151632117-151632139 GGCGGCGCTGGCGGCGGCCCTGG - Exonic
1035432129 7:158829888-158829910 GGCTGCGCTCGCCGAGGCCCGGG + Intronic
1036496404 8:9273861-9273883 AGCTGAACTGGCCGAGGGCCAGG + Intergenic
1036664513 8:10730159-10730181 GGCCGAGCGGGCTGGGGGCCGGG - Intronic
1036710695 8:11076715-11076737 GCCTGCGCTGGCTGAGGCCCCGG - Intronic
1037390603 8:18387605-18387627 GGCCGAGAGGGCCGAGGGCCGGG - Intergenic
1037987581 8:23299456-23299478 TGCTCTGCTGGCCGAGGGCCTGG + Intronic
1038612428 8:29068923-29068945 GGCCGGGCTGGCAGAGGGCCCGG - Exonic
1038782641 8:30581288-30581310 GGCGGCGCTGGGTGAGGGTCTGG - Intronic
1039212689 8:35235336-35235358 GGCGGCGCTGGGCTGGGGCCCGG - Intergenic
1039454548 8:37698178-37698200 GGCGGCGCTGGACGAGAGCGCGG - Exonic
1039512813 8:38105351-38105373 GCCGGCGGTGGCCGCGGGCCTGG - Exonic
1039907546 8:41797789-41797811 GTCCGCGCCGGCCGAGGCCTGGG - Intronic
1039936600 8:42051647-42051669 CGGCGCGCGGGCCGCGGGCCGGG + Intronic
1042956759 8:74259442-74259464 GGCCGCGCTGGCCGCTCGCCAGG - Exonic
1045510871 8:102810893-102810915 GCCCCCGCTCGCCGAGCGCCCGG - Intergenic
1045547344 8:103140704-103140726 GGACGGGCTGGGAGAGGGCCCGG + Exonic
1049213414 8:141396970-141396992 AGCCGGGCTGGCTGGGGGCCTGG + Intronic
1049219121 8:141420855-141420877 GGCAGCACTGACCGAGTGCCTGG + Intronic
1049537456 8:143188944-143188966 GGGCACCCTGGCCGAGGTCCAGG + Intergenic
1049576006 8:143389910-143389932 TGCCGGGGTGGCAGAGGGCCTGG + Intergenic
1049692848 8:143970130-143970152 TGCAGTGCTGGCTGAGGGCCTGG - Intronic
1049707491 8:144049626-144049648 GGCCTCGCTGCCCGTGGGTCTGG + Intergenic
1052999798 9:34571664-34571686 AGCCCCGTTGGCCCAGGGCCCGG - Intronic
1053129161 9:35605541-35605563 GGCCGCGCTTGCCATGGGCGCGG - Exonic
1054906898 9:70420233-70420255 GGCGGCGGGGGCCGCGGGCCGGG - Intergenic
1058885851 9:109320726-109320748 GCCCGCGCAGGCCGCCGGCCCGG - Exonic
1058937181 9:109780201-109780223 GGCCGCGCCAGCCGAGGACGTGG - Intronic
1060106535 9:120876628-120876650 GGCCGCCCTGGGAGAGGCCCCGG - Intronic
1060182870 9:121546085-121546107 GGCTGAGCTGGCCGAGGACGGGG - Intergenic
1060827837 9:126696569-126696591 GGCCCAGCTGGCCGAGGGGAGGG - Exonic
1061248425 9:129413388-129413410 GGCCGCGGCGGGCGGGGGCCGGG - Intergenic
1061260375 9:129477291-129477313 GACCTCGCTGGCCGATGGCCGGG - Intergenic
1061422185 9:130478414-130478436 GGCAGCCCTGCCCGAGGACCAGG + Intronic
1061537937 9:131260986-131261008 GGGCGCGCTGGCCCAGGGGCCGG + Exonic
1061674709 9:132209253-132209275 AGCCGCGCTGGAAGACGGCCTGG - Intronic
1062043966 9:134416675-134416697 ACCCGTGCTGGCTGAGGGCCTGG - Intronic
1062049228 9:134438562-134438584 GGCCCAGCTGGCCGGGGACCTGG - Intronic
1062099829 9:134722261-134722283 AGCAGGGCTGGCTGAGGGCCAGG + Intronic
1062264079 9:135678849-135678871 GGCTGGGCGGGCAGAGGGCCTGG - Intergenic
1062351909 9:136143559-136143581 AGCAGAGCTGGCCGGGGGCCGGG + Intergenic
1062425875 9:136505947-136505969 GGCACTGCTGGCCGAGGGCTGGG - Intronic
1062516947 9:136941622-136941644 GCCCGTGCTGGGTGAGGGCCGGG - Exonic
1062574669 9:137200600-137200622 AGCCGCGCTGGGCGGGGGCGCGG - Exonic
1062592022 9:137278518-137278540 GCCCGGGCTGCCCCAGGGCCAGG - Intronic
1062613813 9:137387145-137387167 GGGAGCGGGGGCCGAGGGCCAGG - Intronic
1203771974 EBV:54100-54122 GGCCGAGGCGGCCGAGGTCCGGG - Intergenic
1203470258 Un_GL000220v1:112902-112924 GGCCGGGCGGGCCGCGGGGCGGG - Intergenic
1203478079 Un_GL000220v1:156874-156896 GGCCGGGCGGGCCGCGGGGCGGG - Intergenic
1185611325 X:1395139-1395161 GGCCGGGCTGGACGGGGCCCTGG + Intergenic
1185778768 X:2828723-2828745 GGCCGCGGCGGGCGAGGGGCGGG + Intergenic
1185877951 X:3714769-3714791 GGCCGCCCTGGTCGCGGGTCAGG - Intergenic
1189659344 X:43279770-43279792 GGCCGGGCGGGCCGGGGGCGGGG + Intergenic
1195626497 X:107009584-107009606 GGCAGGGCTGGCTGAGGGCATGG + Intergenic
1195655316 X:107326891-107326913 GGCAGGGCTGGCTGAGGGCATGG + Intergenic
1195766129 X:108298451-108298473 GGCCGCCCAGGGAGAGGGCCCGG - Intronic
1196684069 X:118495886-118495908 GGCCGCGGCCGCCGCGGGCCGGG + Intronic
1200069572 X:153521285-153521307 GGCGGTGCTGGCAGTGGGCCTGG + Intronic
1200108230 X:153725988-153726010 GCCGGCGATGGCCGAGGGCCAGG - Exonic
1200163284 X:154019853-154019875 GGCCGCGGCGGGCGCGGGCCTGG + Exonic
1200224864 X:154411816-154411838 GGGAGCGCCGGCCGCGGGCCGGG + Exonic
1200239505 X:154486427-154486449 GGGCGGCCGGGCCGAGGGCCGGG - Intronic
1200747096 Y:6911828-6911850 GCCGGCGCTGGGCTAGGGCCTGG + Intronic
1201291244 Y:12421782-12421804 GGCCGCGGTGGGCGAGGGGCTGG - Intergenic