ID: 1161483751

View in Genome Browser
Species Human (GRCh38)
Location 19:4523875-4523897
Sequence GGCCGCGCTGGCCGAGGGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 409}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161483751_1161483758 1 Left 1161483751 19:4523875-4523897 CCCGGCCCTCGGCCAGCGCGGCC 0: 1
1: 0
2: 5
3: 46
4: 409
Right 1161483758 19:4523899-4523921 CTGGCACGTCCCTGAAGCAGCGG 0: 1
1: 0
2: 1
3: 20
4: 159
1161483751_1161483759 2 Left 1161483751 19:4523875-4523897 CCCGGCCCTCGGCCAGCGCGGCC 0: 1
1: 0
2: 5
3: 46
4: 409
Right 1161483759 19:4523900-4523922 TGGCACGTCCCTGAAGCAGCGGG 0: 1
1: 0
2: 1
3: 14
4: 144
1161483751_1161483763 17 Left 1161483751 19:4523875-4523897 CCCGGCCCTCGGCCAGCGCGGCC 0: 1
1: 0
2: 5
3: 46
4: 409
Right 1161483763 19:4523915-4523937 GCAGCGGGCATCAGCGAAGGCGG 0: 1
1: 0
2: 0
3: 13
4: 107
1161483751_1161483762 14 Left 1161483751 19:4523875-4523897 CCCGGCCCTCGGCCAGCGCGGCC 0: 1
1: 0
2: 5
3: 46
4: 409
Right 1161483762 19:4523912-4523934 GAAGCAGCGGGCATCAGCGAAGG 0: 1
1: 0
2: 1
3: 8
4: 108
1161483751_1161483765 26 Left 1161483751 19:4523875-4523897 CCCGGCCCTCGGCCAGCGCGGCC 0: 1
1: 0
2: 5
3: 46
4: 409
Right 1161483765 19:4523924-4523946 ATCAGCGAAGGCGGTCTGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 53
1161483751_1161483764 25 Left 1161483751 19:4523875-4523897 CCCGGCCCTCGGCCAGCGCGGCC 0: 1
1: 0
2: 5
3: 46
4: 409
Right 1161483764 19:4523923-4523945 CATCAGCGAAGGCGGTCTGCAGG 0: 1
1: 0
2: 0
3: 4
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161483751 Original CRISPR GGCCGCGCTGGCCGAGGGCC GGG (reversed) Exonic