ID: 1161487209

View in Genome Browser
Species Human (GRCh38)
Location 19:4542885-4542907
Sequence CCCACTCTGCAGAGGGAAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 334}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161487209_1161487224 18 Left 1161487209 19:4542885-4542907 CCCGCTTCCCTCTGCAGAGTGGG 0: 1
1: 0
2: 1
3: 33
4: 334
Right 1161487224 19:4542926-4542948 CCGGCACCTCGGAGACCCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 150
1161487209_1161487222 17 Left 1161487209 19:4542885-4542907 CCCGCTTCCCTCTGCAGAGTGGG 0: 1
1: 0
2: 1
3: 33
4: 334
Right 1161487222 19:4542925-4542947 ACCGGCACCTCGGAGACCCCCGG 0: 1
1: 0
2: 0
3: 6
4: 127
1161487209_1161487226 26 Left 1161487209 19:4542885-4542907 CCCGCTTCCCTCTGCAGAGTGGG 0: 1
1: 0
2: 1
3: 33
4: 334
Right 1161487226 19:4542934-4542956 TCGGAGACCCCCGGGCCTTCTGG 0: 1
1: 1
2: 0
3: 3
4: 71
1161487209_1161487220 7 Left 1161487209 19:4542885-4542907 CCCGCTTCCCTCTGCAGAGTGGG 0: 1
1: 0
2: 1
3: 33
4: 334
Right 1161487220 19:4542915-4542937 CAAACTCCTAACCGGCACCTCGG 0: 1
1: 0
2: 0
3: 4
4: 53
1161487209_1161487219 -1 Left 1161487209 19:4542885-4542907 CCCGCTTCCCTCTGCAGAGTGGG 0: 1
1: 0
2: 1
3: 33
4: 334
Right 1161487219 19:4542907-4542929 GGGGGGTTCAAACTCCTAACCGG 0: 1
1: 0
2: 0
3: 4
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161487209 Original CRISPR CCCACTCTGCAGAGGGAAGC GGG (reversed) Exonic
900469693 1:2847633-2847655 CCGGCACTGCAGAGGGAAGGAGG + Intergenic
900827868 1:4941064-4941086 TCCACTCAGAAGAGGGCAGCAGG + Intergenic
902085311 1:13855777-13855799 CCCAGGCTGCACAGAGAAGCAGG - Intergenic
902398864 1:16146612-16146634 CTCGCTCAGCAGAGGGGAGCTGG + Intronic
904336681 1:29802465-29802487 CCCACTCAGCTGTGGGGAGCGGG + Intergenic
904768564 1:32868930-32868952 CCAACTCTGCAGTGGTGAGCTGG - Exonic
905241123 1:36582243-36582265 CCCACTGTGCAGGGGGACGCAGG + Intergenic
905570171 1:38997602-38997624 GCTACTCTGCAGGGGGAGGCGGG - Intronic
906519547 1:46458999-46459021 CCCACCCTGAAGATGGGAGCCGG - Intergenic
907409735 1:54275468-54275490 CCTGCTCTCCAGCGGGAAGCAGG - Intronic
908392790 1:63698778-63698800 CCCAGACTGCAGAAGGCAGCTGG + Intergenic
912949704 1:114112177-114112199 TCCACACTGCAGGGTGAAGCTGG - Intronic
913333069 1:117683324-117683346 ACCACTGTGCACAGAGAAGCTGG + Intergenic
915523770 1:156464029-156464051 CCCATTCTCCAGAGGGAGGGAGG - Exonic
915525782 1:156475515-156475537 CTCACTCTGCACTGGGAGGCTGG - Intronic
916424493 1:164667976-164667998 CCCACTCTGGAGGGAGAAGTGGG - Intronic
917923606 1:179771040-179771062 CCCTGTCAGCAGAGGGCAGCAGG - Intronic
918311849 1:183290755-183290777 ACCTCACTGCAGAGGGAGGCAGG - Intronic
919919995 1:202161927-202161949 CCCACTCCGGAGAGGAACGCAGG - Intergenic
920342445 1:205284136-205284158 CCCAGTCTGCAGTGGGCAGGTGG - Intergenic
920353337 1:205352263-205352285 CTCACTCTCCAGATGGAAGGAGG + Intronic
923283636 1:232469024-232469046 CCCACCCTACAGAGGGAGTCAGG - Intronic
1064005840 10:11698303-11698325 CCAACTGAGCAGAGGGTAGCAGG - Intergenic
1064542722 10:16421212-16421234 CCCATTCTCCATAGAGAAGCCGG - Intergenic
1065785781 10:29213223-29213245 CCCAATCAGCAGTGGGAAGTGGG - Intergenic
1065971365 10:30808545-30808567 CGCACTGTGCAGAAGGAAGCAGG + Intergenic
1067239290 10:44476649-44476671 GCTCCTCTGCAGAGGCAAGCTGG - Intergenic
1068714458 10:60172993-60173015 CCCATTCTGTAGAAGGAAGATGG + Exonic
1070933239 10:80275189-80275211 CTCCCTCTGCAGGGGGATGCGGG - Exonic
1071318046 10:84422132-84422154 CTCACTTTGCAGAAGGAAGAAGG + Intronic
1071559439 10:86633498-86633520 ACCACGCTGCAGAGGGGAGCTGG + Intergenic
1072662391 10:97370882-97370904 CCCGCTCTGCCGAGGGAGCCTGG - Intronic
1075625207 10:123959167-123959189 CCCATTCCTCAAAGGGAAGCAGG + Intergenic
1076389858 10:130091019-130091041 CCAGCTCTGAAGAGAGAAGCGGG + Intergenic
1076494836 10:130890155-130890177 CCCTCTCTGCCTAGGGAAGCCGG + Intergenic
1078090087 11:8259644-8259666 CCAACCCTGGAGAGGGAGGCAGG - Intronic
1078149863 11:8749306-8749328 CTCACTCAGTACAGGGAAGCTGG + Intronic
1078315414 11:10289698-10289720 CCCACCCTGCCGAGGGCACCGGG - Intronic
1078443809 11:11389211-11389233 CCAAGTCTTCAGAGGCAAGCAGG - Intronic
1078569033 11:12441730-12441752 CCAAATCTGCTGAGGGAGGCAGG + Intronic
1080785655 11:35472955-35472977 GCCACTCTGCAGAGAGGAGATGG + Intronic
1082790051 11:57340879-57340901 CCACCTCTGCAAAGGGAAGGAGG + Intronic
1083149948 11:60785659-60785681 CCCACCCAGCAGAGGGGATCTGG + Intronic
1083202884 11:61131081-61131103 CCCTCTGGCCAGAGGGAAGCGGG - Exonic
1083277878 11:61607461-61607483 TTCCCTCTGCAGAGGGAAACTGG - Intergenic
1083616345 11:64028414-64028436 TCCACGCTGCAGAGGGAGGAGGG + Intronic
1084012959 11:66362882-66362904 CCCACTCCGCAGAGCCCAGCTGG - Exonic
1084176210 11:67423700-67423722 CTCACTCTCCAGTGGGCAGCAGG - Exonic
1084409220 11:68996855-68996877 CCCTCTGAGCAGTGGGAAGCCGG + Intergenic
1084678605 11:70651681-70651703 CCCACACTCAAGAGGGATGCAGG + Intronic
1084809605 11:71604164-71604186 CCCTCTTTGCAGAAGGCAGCGGG + Intergenic
1087064220 11:94012030-94012052 CCCACTCTGCAGCATGAAGCAGG + Intergenic
1088693823 11:112349425-112349447 CCCACGCTGCAGAGCTCAGCTGG + Intergenic
1088897211 11:114087650-114087672 CCTACTCTGCTCAGGGAAGTGGG - Intronic
1089528322 11:119111035-119111057 ACCTCTCTGCAGAGAGAAGAAGG - Exonic
1090074422 11:123571022-123571044 GGCGCACTGCAGAGGGAAGCAGG + Intronic
1090662059 11:128889968-128889990 CCCCCTCTACAGAGAGAAGAGGG + Intergenic
1091184565 11:133636121-133636143 CTGACTTTGCAGAGTGAAGCTGG - Intergenic
1091255051 11:134176383-134176405 CCTCCTGTGCAGAGAGAAGCCGG + Exonic
1091647984 12:2288252-2288274 CTCACTCCTCAGAGAGAAGCTGG - Intronic
1093905749 12:24690165-24690187 ACCAAACTGCAGAGGGAGGCTGG + Intergenic
1094334899 12:29338530-29338552 CCTACTCAGCAGATGGAAGCAGG + Exonic
1095573926 12:43713162-43713184 GCCAGTGTGCAGAGGGAAGGAGG - Intergenic
1096182452 12:49558173-49558195 CCCAGCCTGCAGAGGGAGACCGG - Exonic
1096543454 12:52321520-52321542 GCCACACTGAAGAGGCAAGCAGG - Intergenic
1097411465 12:59258757-59258779 CTGACTCTGAAGATGGAAGCAGG + Intergenic
1097989740 12:65823043-65823065 CCAGCTCTGCAAAGGGCAGCTGG + Intergenic
1101785038 12:107875111-107875133 CCTAATCTGCAGAAGGTAGCTGG + Intergenic
1102986520 12:117282943-117282965 TACACTGTGCTGAGGGAAGCAGG - Intronic
1103140749 12:118545953-118545975 TCCACTCTGCAGAAGGAGGTGGG + Intergenic
1103565044 12:121811333-121811355 CCCCCTCTTCAGAGGGCACCAGG - Intronic
1104828106 12:131729084-131729106 CCCACTCAGCAGAGGCAATGGGG + Intronic
1104979621 12:132568021-132568043 CCCCCTCTGGAGAGGGTTGCTGG - Intronic
1106234497 13:27850738-27850760 ACCACTGTGCTGAGGGAAGCAGG + Intergenic
1108005410 13:45941425-45941447 CCCCAGCTGCAGAGGGAGGCTGG - Intergenic
1111263569 13:85776463-85776485 ACCACTCTGTGAAGGGAAGCAGG - Intergenic
1112330885 13:98476244-98476266 CCCACTCTGCAGGGGGCGGGGGG - Intronic
1113242466 13:108353688-108353710 CCATCTCTGCAGGGGGAAACTGG + Intergenic
1113638380 13:111938068-111938090 CGCACTCAGCAGATGGAAACAGG - Intergenic
1114654435 14:24307693-24307715 CCCACTGTGGAGTGGGGAGCAGG + Exonic
1116696209 14:48181916-48181938 CCCACTCAGCTGTGTGAAGCAGG - Intergenic
1117253426 14:53956057-53956079 CGCACTCTCCAGAGGCCAGCAGG + Intronic
1117827600 14:59719721-59719743 CCCAGACTTCAGAGGGAAGTAGG + Intronic
1118470987 14:66075181-66075203 CTCAGGCTGCAGAGGGAGGCAGG - Intergenic
1118731361 14:68669350-68669372 CGTGCTCTGGAGAGGGAAGCAGG - Intronic
1118921098 14:70150676-70150698 CTCTCTTTGCAGAGGAAAGCAGG + Intronic
1119024193 14:71139660-71139682 CCCTCTGTGCGGATGGAAGCAGG - Intergenic
1119415739 14:74468051-74468073 CTCCCTGTGCAGAGGGAAGCTGG + Intergenic
1122241101 14:100368073-100368095 CCCCCACTTCAGAGGGAAGCAGG + Intronic
1122997771 14:105274826-105274848 CCCACTGTGCAGACAGAAGTGGG - Intronic
1124954907 15:34353972-34353994 GCCACTCTCCAGAGGGAAAGTGG - Intronic
1126367295 15:47908304-47908326 CTGCCTTTGCAGAGGGAAGCTGG + Intergenic
1126676099 15:51160380-51160402 CCCACCCTTCAGAGGGGGGCAGG + Intergenic
1127965844 15:63922448-63922470 CCCCTTCTGCAGAGGGAGGATGG - Intronic
1128118231 15:65126169-65126191 GCCACTTTCCAGAAGGAAGCAGG + Intronic
1129033681 15:72637189-72637211 CCCACTCGGGAGAGGGATGGCGG - Intergenic
1129895463 15:79102429-79102451 CACACTCTGCAGACAGAAGGCGG - Intergenic
1129907390 15:79198084-79198106 TGCAGGCTGCAGAGGGAAGCAGG - Intergenic
1132330853 15:101011697-101011719 ACCACACTGGAGAGAGAAGCTGG - Intronic
1132591786 16:729276-729298 CCCTCCCTGCAGAGAGGAGCCGG + Exonic
1132748586 16:1447117-1447139 CCCACACAGCAGAGGCAGGCGGG + Intronic
1132781903 16:1631464-1631486 ACCACTTTGCAAAGGGAAGCTGG - Intronic
1132802956 16:1763166-1763188 CCCTCCCTGCAGCGGGGAGCTGG + Intronic
1132804488 16:1769270-1769292 CTCACTCTGCCTAGGGGAGCTGG + Exonic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1134293582 16:12924125-12924147 CCCACTCAACTGATGGAAGCAGG - Intronic
1135406486 16:22201810-22201832 CCCACTGTGCACAGGGAATTTGG + Intergenic
1136118325 16:28110461-28110483 CCCACTCTGCTGACCCAAGCTGG + Intronic
1136171760 16:28494280-28494302 GCCACTCTGCAAGAGGAAGCTGG - Intronic
1137381498 16:48003557-48003579 GCCTGTCTGCAGAGGGAAGGAGG + Intergenic
1137536143 16:49327711-49327733 GCCACTCTGCAGAAAGAAGGTGG - Intergenic
1138188542 16:54995822-54995844 CCCAGTCTGCAGAAAAAAGCAGG - Intergenic
1138282888 16:55785624-55785646 TCCACTCTCCAAAGGGAAACTGG + Intergenic
1138439062 16:57023597-57023619 TCCACTCTGCAAATAGAAGCTGG + Intronic
1138604429 16:58079148-58079170 TCCACTCTCCTGAGGCAAGCAGG - Intergenic
1139392778 16:66615630-66615652 CCCACTCTGCAGTGGCAGGAAGG + Exonic
1139454308 16:67060090-67060112 CTCAGTCTGCAGAGAGTAGCGGG + Intronic
1139558510 16:67727625-67727647 CCAGGTCTGCAGAGGGAAGTGGG - Intronic
1139647600 16:68342795-68342817 CACAGCCTGCAGAGGGATGCTGG - Intronic
1139955481 16:70691140-70691162 ACAAGTTTGCAGAGGGAAGCTGG - Intronic
1140368224 16:74397862-74397884 CCCACTATGCAGAGGAAAAGGGG + Intergenic
1140481072 16:75263217-75263239 GCCTCTCTGCAGCTGGAAGCTGG + Intronic
1140518614 16:75563212-75563234 CCAGCTCTGTAAAGGGAAGCAGG + Intergenic
1141422578 16:83926323-83926345 CCCACCCTGCACTGGGAAGGAGG + Exonic
1141458260 16:84159198-84159220 GGCACTCAGCAGAGGTAAGCGGG + Intronic
1141738129 16:85869072-85869094 TTCACTGTGGAGAGGGAAGCAGG + Intergenic
1142238516 16:88934532-88934554 CACACTGTGCACAGGGAAGATGG - Intronic
1142742726 17:1940547-1940569 CCCAGCCTGCAGGGGGAGGCAGG + Intronic
1142899737 17:3004538-3004560 ACCTCTGTGCAGAGGGAAGGCGG + Intronic
1142979428 17:3663197-3663219 CCCACTCTCCCGAGGGGTGCTGG - Exonic
1143102582 17:4512553-4512575 CCCAGGGTACAGAGGGAAGCAGG - Intronic
1144058307 17:11560189-11560211 CACACCCTGCAGAGGGGAGAAGG - Exonic
1144148899 17:12424301-12424323 CCTACCCTGCAGAGGTCAGCTGG + Intergenic
1145795448 17:27652975-27652997 CCCATTTTGCAGAGGGAAGGGGG - Intergenic
1146255233 17:31388490-31388512 CCCACTAAGCAAAGGGAGGCAGG + Intergenic
1146603333 17:34236818-34236840 CACATTCTGCTGAGGGCAGCTGG - Intergenic
1147452614 17:40515190-40515212 CCTTCTCTGCAGACAGAAGCAGG + Intergenic
1148000866 17:44386126-44386148 GCCACTCTGCATAGGAAAGCTGG + Exonic
1148336969 17:46848452-46848474 CCCACAGGGCAGAGGGAAGGTGG + Intronic
1148698870 17:49576486-49576508 CCCACTCCGCAGCGGGTGGCTGG + Intronic
1149539911 17:57461078-57461100 CCCACTCTTCAGAGGAAATGGGG - Intronic
1152022732 17:77789315-77789337 CGGGCTCTGCAGAGGGAAGAAGG - Intergenic
1153951668 18:10062808-10062830 AGCACTCTTCAGAGGGGAGCAGG + Intergenic
1154326189 18:13392488-13392510 TCCTCTGAGCAGAGGGAAGCAGG + Intronic
1157547292 18:48555440-48555462 CCCACTTTGCAGAGGAAGGCTGG + Intronic
1159131779 18:64288187-64288209 ACCGTCCTGCAGAGGGAAGCAGG - Intergenic
1161003570 19:1923429-1923451 TCCAGACTCCAGAGGGAAGCAGG + Intronic
1161043878 19:2124155-2124177 TCCAGACTCCAGAGGGAAGCAGG - Intronic
1161286737 19:3472223-3472245 TCCTCTCTGCAGCGGGAAACGGG + Intergenic
1161487209 19:4542885-4542907 CCCACTCTGCAGAGGGAAGCGGG - Exonic
1161781532 19:6296333-6296355 CCTACTCGGGAGAGGGAGGCAGG - Intergenic
1162049082 19:8021327-8021349 CCCACTCTGAAAACAGAAGCCGG + Intronic
1162327635 19:10008231-10008253 ACCTCTCTGCAGAGGAAAGAGGG + Intronic
1162471812 19:10876679-10876701 CCCCCTCTGCACAGGGAAAATGG - Intronic
1162527853 19:11217055-11217077 CCCTCTCTGCTGAGTCAAGCCGG - Exonic
1162529806 19:11229290-11229312 CCCACTGTGCAGAAGGTAGTGGG - Intronic
1162680160 19:12334497-12334519 CACACTCTGCAGAGGGCACAGGG - Intergenic
1162897785 19:13775778-13775800 CCCACTCCACGGAGGTAAGCGGG - Intronic
1163102677 19:15107627-15107649 CCCAGTCTGCAGCGGGGTGCGGG - Intronic
1163408143 19:17136377-17136399 CCAGCTCTCCAGAGGGTAGCTGG - Intronic
1163688329 19:18724979-18725001 GCCAGTGTGCTGAGGGAAGCTGG - Intronic
1163815972 19:19464788-19464810 CCCACTCCCCAGAGGTGAGCAGG + Intronic
1164039705 19:21483738-21483760 CCCACTCAGCAGCGGGGAGGAGG + Intronic
1164984678 19:32639621-32639643 CACACTCTGCAGAGAGATCCAGG - Intronic
1165119412 19:33549467-33549489 CCCTCTCTGTAGAGCCAAGCGGG + Intergenic
1165294452 19:34915464-34915486 GCCACTCTGCAGAGGCATGCAGG + Intergenic
1165906190 19:39196347-39196369 CCCACTCTGCAGAGGGGGAGTGG - Intergenic
1166454395 19:42928698-42928720 CTCCCTCTGCAGAGGGCAGGTGG + Intronic
1166985672 19:46659106-46659128 TCCACTCTTCAGAGGGACCCAGG + Intronic
1167115972 19:47489269-47489291 TCCACCAGGCAGAGGGAAGCTGG + Intronic
1168357092 19:55707629-55707651 CCCAGTCTGCAAAGGAAAGATGG - Intronic
1168717896 19:58539802-58539824 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718045 19:58540422-58540444 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718288 19:58541390-58541412 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718397 19:58541853-58541875 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718489 19:58542240-58542262 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718539 19:58542436-58542458 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718619 19:58542784-58542806 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
925440234 2:3879356-3879378 ATGAGTCTGCAGAGGGAAGCCGG + Intergenic
926135667 2:10334083-10334105 GCCACTCTGCGGAGGGAAGTAGG + Intronic
927318917 2:21720109-21720131 CCCCTTCTGCAGAAGGGAGCTGG - Intergenic
927484107 2:23477241-23477263 CCCCTGCTGCAGAGGGAAGCTGG - Intronic
927887683 2:26728639-26728661 CCCACTGGGCAGAAGGCAGCAGG - Exonic
928999596 2:37332985-37333007 CCTACTCCGCTGAAGGAAGCGGG + Intergenic
930479206 2:51926003-51926025 CCAACTGTGCAGAGGGAGCCTGG + Intergenic
932124688 2:69133106-69133128 CCCCTTCTGCAAAGCGAAGCTGG + Intronic
932125741 2:69144236-69144258 GCCACTGGGCAGAGGGAGGCTGG - Intronic
932264596 2:70356653-70356675 ACCAATCTACAGAGAGAAGCAGG + Intergenic
933610986 2:84435079-84435101 ACAAGTCTGGAGAGGGAAGCTGG - Intronic
935321725 2:101896060-101896082 CCCACACTGCACAGGCAGGCTGG - Intergenic
936722827 2:115274050-115274072 TGCGCTCTACAGAGGGAAGCAGG - Intronic
938248463 2:129796476-129796498 CCTTCACTGCAGTGGGAAGCTGG - Intergenic
940769750 2:157827303-157827325 CCCACTGTGCAGAGAGAACAAGG + Intronic
943112293 2:183621494-183621516 CCAGCTCTGAAGAGAGAAGCAGG - Intergenic
945910181 2:215640010-215640032 GCCAGTCTGCAGAGCAAAGCAGG - Intergenic
946152547 2:217786039-217786061 TCCAGGCTGCACAGGGAAGCAGG - Intergenic
946747343 2:222859786-222859808 GCAGCTCTGCAGAGAGAAGCAGG - Intergenic
946805662 2:223468997-223469019 CCTGCTCTGTAGAGGGCAGCTGG - Intergenic
947369300 2:229428202-229428224 CCCATTCTCCAAAGGGTAGCTGG - Intronic
947743013 2:232493498-232493520 ACAGCTCTGCAGAGGGCAGCAGG + Intergenic
947917913 2:233846545-233846567 CCCACTCAGCAGAGGATAGAGGG - Intronic
948082350 2:235216595-235216617 CCCACTGTGGAGTGGGAGGCAGG + Intergenic
948672814 2:239579350-239579372 CGCCCTCTGCAGAGGGACGAGGG + Intronic
948804915 2:240449326-240449348 CCCACGCTGCAAAGGGCCGCCGG + Intronic
1168951165 20:1803231-1803253 GCCTGTCTGCAGGGGGAAGCGGG - Intergenic
1168977776 20:1980910-1980932 CCCATTCCTCAGAGGGCAGCAGG + Exonic
1169171051 20:3465694-3465716 CCAACACTGCTGAAGGAAGCTGG + Intergenic
1169413189 20:5392260-5392282 TCAACTATGCAGAGGGAAGAGGG - Intergenic
1170905244 20:20509530-20509552 CCCCTTCTGCAGAGGGAATCAGG + Intronic
1171311138 20:24145493-24145515 TGCACACTGAAGAGGGAAGCTGG - Intergenic
1172445532 20:34991210-34991232 CCCTGTCTGGAGGGGGAAGCAGG + Intronic
1172839441 20:37893308-37893330 CCCACCCTGCAGGGTGCAGCTGG + Intergenic
1172964980 20:38828215-38828237 CCCACTCAGCTGGGAGAAGCGGG - Intronic
1173862794 20:46295152-46295174 CGGCCTCTGCAGAGGGCAGCAGG - Intronic
1174181264 20:48676467-48676489 CCCACTCTGTAGGTGGAAGGAGG - Intronic
1174340430 20:49891770-49891792 CCCACCATGCAGGTGGAAGCAGG - Exonic
1175896505 20:62338145-62338167 CACACACTGCAGAGCGGAGCGGG + Exonic
1175972230 20:62692326-62692348 CCTGCTCTGCAGTGGGCAGCTGG - Intergenic
1176254434 20:64143601-64143623 CCAGCTCTGCAGAGGGAACATGG - Intergenic
1176517570 21:7797500-7797522 TCCACACAGCATAGGGAAGCAGG - Intergenic
1176703124 21:10082573-10082595 CCTACACTGCAGAGGGTAGAGGG + Intergenic
1178490516 21:33048123-33048145 CCCCACCTGCAGAGGCAAGCAGG + Intergenic
1178651598 21:34427512-34427534 TCCACACAGCATAGGGAAGCAGG - Intergenic
1178719047 21:34992134-34992156 CCCTCTCAGGAGAGTGAAGCGGG + Intronic
1181397991 22:22634883-22634905 GCCACAGTGCAGAGGGAGGCGGG - Intergenic
1181573886 22:23782057-23782079 CCCCACCCGCAGAGGGAAGCGGG - Intronic
1181651414 22:24261175-24261197 GCCACAGTGCAGAGGGAGGCGGG + Intergenic
1182252105 22:29009082-29009104 GCCACTGTGAAGAGGGAATCAGG + Intronic
1183209652 22:36442999-36443021 GCCCCTCTGCAGACTGAAGCAGG - Intergenic
1183705214 22:39471598-39471620 CCATCTCTGCAGAGGAAGGCCGG - Intronic
1183718445 22:39548144-39548166 CCCAGCCTGCAGAGGGGAGCAGG - Intergenic
1184193758 22:42912499-42912521 GCCACTCTGGAGAGGGGAGTAGG - Intronic
1184932713 22:47693028-47693050 CCCATTGTGCAGAGAGAAGGTGG - Intergenic
1185019100 22:48363206-48363228 CCAACTCTGCAGAGAGCAGGAGG + Intergenic
1185225754 22:49651073-49651095 CCAAGTCTGCAGAGTGAATCCGG + Intronic
1185303648 22:50099573-50099595 CACACTCTCCAGAGAGAAGTAGG - Exonic
1185392731 22:50571344-50571366 CCCTCTCAGCAGCGGGAGGCGGG + Intronic
950477547 3:13223512-13223534 CCTTCTCATCAGAGGGAAGCTGG + Intergenic
952652612 3:35744471-35744493 GCCACTGTGCAGTGGGAAGGGGG + Intronic
953075251 3:39564148-39564170 CCCAGTATGCAGAAGGTAGCAGG - Intergenic
953833814 3:46326159-46326181 CCTACTCTGGACAGGGCAGCTGG + Intergenic
953921274 3:46953713-46953735 CCCAGGCTGCAGAGGGACGCTGG - Intronic
954080045 3:48208194-48208216 CAGACTCTGCTGAGAGAAGCTGG + Intergenic
958772160 3:98437887-98437909 CCCACTCTGAACAAGGAGGCAGG + Intergenic
960279801 3:115768550-115768572 AGCACTCTGCAGATAGAAGCAGG + Intergenic
961678704 3:128584301-128584323 CCCCATCAGCAGAGGGAAGGAGG - Intergenic
962855592 3:139341887-139341909 GCCACTCTGCAGAGAGAGGCAGG - Intronic
963667866 3:148212508-148212530 CCCTCTCTGCACTGGGAAGAGGG + Intergenic
964760130 3:160127593-160127615 CTCACTTTGCAGAGGGTAGTGGG + Intergenic
966875714 3:184320520-184320542 CCCACCCCCCAGCGGGAAGCAGG - Intronic
968037765 3:195562532-195562554 TCCACTCTCCGGAGGGAACCAGG + Intergenic
968648202 4:1750166-1750188 CCCACTCTGCAGAGAGAGGAGGG + Intergenic
968797028 4:2713719-2713741 AACACTCAGCAGAGGCAAGCGGG - Intronic
969043292 4:4317986-4318008 CCCACTGTACAGAGGCATGCTGG - Intronic
969162019 4:5268756-5268778 CCCCCTCTGCAGCCGAAAGCAGG + Intronic
969312539 4:6362290-6362312 CCCATCCTGAAGAGGGAAGCAGG + Intronic
969683351 4:8655632-8655654 CGGCCTCTGCACAGGGAAGCAGG + Intergenic
971422799 4:26489479-26489501 GCCACTCTGCAGAGAGAAACAGG + Exonic
972305549 4:37826697-37826719 CTACCGCTGCAGAGGGAAGCAGG - Exonic
978387694 4:108192309-108192331 CCCTCTGGGCAGAGGGAATCAGG + Intergenic
980375326 4:131938940-131938962 CCTACACTGCAGAGGGTAGAGGG + Intergenic
981354148 4:143767431-143767453 CCCACTCTGCTCAGTGCAGCAGG - Intergenic
981799074 4:148635242-148635264 CAAAATCTGCAGAGAGAAGCAGG + Intergenic
983491802 4:168398134-168398156 CCAAACCTGCAGAGGGAAGGGGG - Intronic
985678503 5:1244247-1244269 CCCAGACTGCAGCGTGAAGCAGG - Exonic
985908325 5:2859386-2859408 CCCACTCTCCAGAAGGCAACTGG + Intergenic
985936731 5:3103159-3103181 CCCACCCTGCAGATGGATGGGGG - Intergenic
985964469 5:3329531-3329553 GCCACTCTGCAGAGGCTGGCAGG + Intergenic
987218854 5:15768764-15768786 GCCACTGTGCACAGGGAGGCAGG - Intronic
987663005 5:20902008-20902030 CTCCCTCTTCAGAAGGAAGCAGG - Intergenic
988759682 5:34300175-34300197 CTCCCTCTTCAGAAGGAAGCAGG + Intergenic
991199101 5:63970465-63970487 CCCACTCTGGAGGCGGAGGCAGG - Intergenic
991459156 5:66838629-66838651 CCTGCTCTGCGGAAGGAAGCCGG + Intronic
993905934 5:93622625-93622647 GCCAGTCTGCAGAGGAAAGGAGG - Intronic
996016391 5:118538611-118538633 CTCACTTTGCAGATGGAAGACGG - Intergenic
996318887 5:122191862-122191884 ACCTCACTGCAGAGGGAAGTTGG + Intergenic
996837391 5:127808609-127808631 CTCACTCTGCAAAGGGATGGAGG - Intergenic
997889257 5:137660411-137660433 CCCACTGTCCTGTGGGAAGCTGG - Intronic
998151197 5:139758545-139758567 CCCACACTGCACAGGGGAGGAGG - Intergenic
1000464791 5:161562441-161562463 CCAACTCTGCAGCACGAAGCAGG - Intronic
1001278994 5:170372453-170372475 CAACCTCTGCAGAGGGAAGAGGG - Intronic
1001448839 5:171808390-171808412 CCACCTCTGCAGAGGGATGCGGG + Intergenic
1001534286 5:172487887-172487909 CACGCTCTGAAGAGGGACGCAGG - Intergenic
1002093630 5:176818331-176818353 CCCAGCCTGCAGAGGACAGCCGG - Intronic
1002447339 5:179297593-179297615 GTCACCCTGGAGAGGGAAGCCGG - Intronic
1004808680 6:19234161-19234183 CTTAATCTGCAGAGGGAAGGGGG + Intergenic
1005033132 6:21530031-21530053 CCCACACTGCAGAAGGAGACAGG - Intergenic
1006456874 6:34136985-34137007 TTCCCTCTGCAGAAGGAAGCAGG - Intronic
1006989878 6:38206030-38206052 TCCAGACTGCAGAGGGAAGGCGG + Intronic
1007453835 6:41960978-41961000 TCCCCTCAGCAGAGGGAAGCTGG + Intronic
1007987030 6:46217173-46217195 TCCACTCTGAAGTGGGGAGCTGG + Intergenic
1008564234 6:52751574-52751596 CACCTTCAGCAGAGGGAAGCTGG + Exonic
1008568548 6:52792853-52792875 CACCTTCAGCAGAGGGAAGCTGG + Exonic
1008573003 6:52832856-52832878 CACCTTCAGCAGAGGGAAGCTGG + Exonic
1008577382 6:52874066-52874088 CACCTTCAGCAGAGGGAAGCTGG + Intronic
1011217853 6:85024414-85024436 GCCACTTTGCAGAGGGTCGCGGG - Intergenic
1013339866 6:109203170-109203192 CCCACACTGGAGGGGGAAGAAGG + Intergenic
1013652423 6:112209227-112209249 CCCTCTCTGCAGAAGAAAACAGG + Intronic
1013982230 6:116145162-116145184 CTCACTCTGCAGTGAGAAGTTGG + Intronic
1014314189 6:119842725-119842747 TACACTCTGTAGAGGGAAGGAGG - Intergenic
1015264980 6:131281766-131281788 TAGACTCAGCAGAGGGAAGCAGG - Exonic
1015785978 6:136922050-136922072 GACGCTCTGCGGAGGGAAGCGGG - Intergenic
1016103220 6:140128661-140128683 CCCACCCTTCAGAGGGGAGAAGG - Intergenic
1016350050 6:143156972-143156994 CTGACTCTGAAGAGGGAATCTGG + Intronic
1016498477 6:144690671-144690693 CCCAGTCTCCAGAGGGATGAAGG - Intronic
1017110071 6:150924120-150924142 CCCACTGGGCAAAGAGAAGCAGG + Intronic
1018928161 6:168221687-168221709 CCAAATCTACAGAGTGAAGCAGG - Intergenic
1019388851 7:774094-774116 CCCAATCTGCAGTGGCATGCGGG + Exonic
1019631913 7:2053982-2054004 ACCCTTCTGCAGAGGGAGGCAGG + Intronic
1019898488 7:4001187-4001209 GCCCCTCTCCAGATGGAAGCTGG - Intronic
1021575018 7:22098977-22098999 CCCAGTCTGCAGAGCGGGGCAGG + Intergenic
1022844692 7:34198125-34198147 CCCACTCTCCAGAAGGGAGTGGG - Intergenic
1022905020 7:34847467-34847489 CCCAAGCTGCAGTTGGAAGCTGG + Intronic
1022993284 7:35729205-35729227 CCCACTCTGCAGAGCAGATCAGG - Intergenic
1023923089 7:44645189-44645211 CCCACTGTCCAGGAGGAAGCAGG + Intronic
1024374199 7:48619066-48619088 CCCACTTTGCAGAGGAAGGCAGG + Intronic
1030019372 7:105257993-105258015 CCTACTCTGGAGGGGGAGGCAGG + Intronic
1030078639 7:105758457-105758479 CACACTCTTCAGTGTGAAGCAGG + Intronic
1032056091 7:128685400-128685422 CCCAGTCTGCAAATGAAAGCTGG + Intronic
1032093432 7:128923538-128923560 CCCACTGTTTAGAGGGAAACAGG + Intergenic
1032500583 7:132396861-132396883 CACCCTCTCCAGAGTGAAGCAGG + Intronic
1033081870 7:138306334-138306356 CCTACTCTGGGGAGGGAAGGGGG - Intergenic
1034902781 7:154917844-154917866 CCCACGCTGAAGAGAGAAGTGGG + Intergenic
1034975920 7:155449295-155449317 CCCCCTCTTCAGAGGGAAATCGG - Intergenic
1035345260 7:158193182-158193204 CCCACCCTGCTGAGGGCGGCAGG + Intronic
1035847666 8:2882662-2882684 CCCACTCAGCAGAAGGAGGATGG - Intergenic
1037536778 8:19832170-19832192 CACATTCTGCATAGGAAAGCTGG - Intronic
1039665479 8:39522614-39522636 CCCAGGCTGCAGTGGGAAGTGGG - Intergenic
1042459578 8:69047672-69047694 CTGACTCTGCTGAGAGAAGCAGG - Intergenic
1043706616 8:83358447-83358469 ACCAGTCTGGAGAAGGAAGCAGG + Intergenic
1044721846 8:95158538-95158560 CCTACTCAGCAGACTGAAGCAGG - Intergenic
1045265689 8:100617025-100617047 CCCACTCAGCAGATGGAAAAGGG + Intronic
1045296276 8:100874131-100874153 TCCTGTCTGCAGAGAGAAGCAGG - Intergenic
1045544267 8:103114024-103114046 CCATCTCTGCAGTGGGAAGCTGG + Intergenic
1045686811 8:104721043-104721065 CCCACTCTGCAAACAGGAGCTGG - Intronic
1047967367 8:130056322-130056344 CCCACTCTGCTGACAGAGGCTGG + Intronic
1049275758 8:141719346-141719368 ACCCCTCTGCAGGAGGAAGCTGG + Intergenic
1049508854 8:143017988-143018010 CCCAGCCTGGAGCGGGAAGCAGG + Intronic
1050296137 9:4207239-4207261 CACACTATGCAGAGGGAAGGTGG + Intronic
1052641228 9:31167628-31167650 CCTGCTCTGCAGAGGGAAGCAGG - Intergenic
1053447480 9:38164185-38164207 CTCACTGTGCAAAGGGAAGCAGG + Intergenic
1053484926 9:38445240-38445262 CCCACTCTGCACTGAGAAGTGGG + Intergenic
1053640383 9:40069606-40069628 CCTACACTGCAGAGGGTAGAGGG + Intergenic
1053765752 9:41395867-41395889 CCTACACTGCAGAGGGTAGAGGG - Intergenic
1054321078 9:63665602-63665624 CCTACACTGCAGAGGGTAGAGGG + Intergenic
1054544365 9:66307020-66307042 CCTACACTGCAGAGGGTAGAGGG - Intergenic
1055030333 9:71767700-71767722 CCAACTCTGCAGAGAAAAGCTGG + Intronic
1056560118 9:87722811-87722833 GCCCCTCTGCAGGAGGAAGCTGG + Intergenic
1056568158 9:87792991-87793013 CACCCTCTGCAGGAGGAAGCTGG - Intergenic
1056688044 9:88782912-88782934 ACCACACAGCAGAAGGAAGCTGG - Intergenic
1056793826 9:89642868-89642890 CACAGTCTACTGAGGGAAGCAGG - Intergenic
1060722130 9:125986410-125986432 CTCACTCTGGTCAGGGAAGCTGG + Intergenic
1060893151 9:127201333-127201355 CCCACCTTGCTGAGGGGAGCAGG + Intronic
1061055448 9:128220073-128220095 CCCCCTGCGCAGAGGTAAGCAGG + Exonic
1061593350 9:131613167-131613189 CCCACTGCACAGAGGAAAGCGGG + Intronic
1061906758 9:133703075-133703097 CCCGCTCTGGGGAGGGAAGCGGG - Intronic
1202788153 9_KI270719v1_random:52679-52701 CCTACACTGCAGAGGGTAGAGGG + Intergenic
1185527563 X:791529-791551 CCCACTGTGCAGAGAGAAAAAGG + Intergenic
1186816258 X:13240872-13240894 CCATCTCTGTAGAGGGAAGTGGG + Intergenic
1188001198 X:24983942-24983964 CTCATTTTGCAGACGGAAGCAGG - Intronic
1189992642 X:46609269-46609291 CACTCTTTGCAGAGGGAAGCAGG + Intronic
1192161109 X:68788472-68788494 CACACACTGGAGAGGGATGCAGG + Intergenic
1192233017 X:69278699-69278721 CCCACTTGGCAGAGGCGAGCCGG + Intergenic
1197757101 X:130003019-130003041 CCCACTCTGCAGAGATGAGGAGG + Intronic
1198043292 X:132875447-132875469 CCCAGTCTGCAAAGGCTAGCGGG + Intronic
1199119060 X:144029490-144029512 CCCAGGCTGCACAGGGTAGCAGG - Intergenic
1199267553 X:145845973-145845995 GCCACACTGGAAAGGGAAGCTGG + Intergenic
1199395408 X:147331286-147331308 ACCACTCTGCAGTGCGAAGCTGG - Intergenic
1200961402 Y:8999434-8999456 CCAACTCTGTTGAGGGAAACAGG - Intergenic