ID: 1161488874

View in Genome Browser
Species Human (GRCh38)
Location 19:4550821-4550843
Sequence GTCCATCTGGACGCCGGTGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161488874_1161488882 4 Left 1161488874 19:4550821-4550843 CCGGCACCGGCGTCCAGATGGAC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1161488882 19:4550848-4550870 GGGACTTCTGCTCTCGGAAGCGG 0: 1
1: 0
2: 2
3: 12
4: 166
1161488874_1161488881 -2 Left 1161488874 19:4550821-4550843 CCGGCACCGGCGTCCAGATGGAC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1161488881 19:4550842-4550864 ACTCGGGGGACTTCTGCTCTCGG 0: 1
1: 0
2: 1
3: 8
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161488874 Original CRISPR GTCCATCTGGACGCCGGTGC CGG (reversed) Exonic
900229380 1:1548670-1548692 GTCCATGTGGAAGCCAGGGCAGG - Intronic
901259918 1:7863901-7863923 GGCCATCTGGAGGCTGGTGCTGG + Intergenic
907400119 1:54220127-54220149 GTCCAGCTGGAGGCCACTGCGGG + Intronic
920574687 1:207050820-207050842 GTCCAGCCGGACCCGGGTGCGGG - Exonic
1070816577 10:79328319-79328341 GTCCATCTGCACGCTGCTGGGGG - Intergenic
1074711968 10:116184880-116184902 GTCCATCTGTAGGGCAGTGCAGG + Intronic
1076178984 10:128391269-128391291 GTCCATCTGGAAGGTGGTGTTGG + Intergenic
1076581486 10:131514988-131515010 GTCCCACTGGACGTCTGTGCTGG + Intergenic
1077086873 11:757262-757284 GGCCATCTGGACATGGGTGCAGG - Intronic
1113849013 13:113407464-113407486 GGGCATCTTGACGCAGGTGCTGG + Intergenic
1113950981 13:114070558-114070580 GTCCATTTGGAGGGCTGTGCGGG - Intronic
1114673532 14:24427384-24427406 GTCCATCTGGGCTCCTGTGGGGG + Exonic
1116653836 14:47626917-47626939 CTCCACCTGCACCCCGGTGCGGG + Intronic
1118767638 14:68920855-68920877 CTCCATCTGGTCGCCTGTGGAGG - Intronic
1134823625 16:17266823-17266845 GTCCTTTTGGAAGCAGGTGCAGG - Intronic
1136111723 16:28067674-28067696 GTCTCTCTGGAGGCAGGTGCAGG - Intergenic
1138813609 16:60178841-60178863 GTCCCTCTGGACTCTGGTGTAGG - Intergenic
1143872244 17:9965465-9965487 GACCATATGGACACCGGTGGGGG + Intronic
1144793236 17:17873600-17873622 TTCCATCAGGCCGCCGGTGCTGG - Intronic
1144876665 17:18400678-18400700 GTACATCTGGACGCCTGGGGTGG + Intergenic
1145155562 17:20543741-20543763 GTACATCTGGACGCCTGGGGTGG - Intergenic
1145935198 17:28711185-28711207 GCCCACCCGGACGCCGGGGCGGG - Intronic
1146886088 17:36472014-36472036 CTCCTTCTGGACGCTGGGGCTGG - Intergenic
1149869636 17:60170095-60170117 GTCCATCTGGACACCATGGCAGG - Intronic
1149982369 17:61321557-61321579 GGCCATCTGGATGCCCCTGCAGG + Intronic
1150133539 17:62681787-62681809 GCCCAGCTGGGGGCCGGTGCTGG + Intronic
1150807974 17:68334191-68334213 GTCCATCTGGAAGCCTGGCCTGG - Intronic
1152382923 17:79951567-79951589 GACCAGCTGGCCGCTGGTGCAGG + Exonic
1156486921 18:37472233-37472255 GTCCATAAGGACGCTGGAGCTGG - Intronic
1159071336 18:63626724-63626746 GTCCCTCTGGACTCCAGTGTTGG + Intergenic
1160738568 19:675843-675865 GTCCACCTGGCCGCTGGAGCCGG - Intergenic
1161203463 19:3028653-3028675 GTTCACCTGGGCGCCGGGGCGGG - Intronic
1161488874 19:4550821-4550843 GTCCATCTGGACGCCGGTGCCGG - Exonic
1161806159 19:6444194-6444216 GGCTATCTGGCCGCAGGTGCTGG + Exonic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
926035049 2:9630158-9630180 ATCCATCTGCACCACGGTGCTGG - Exonic
947874874 2:233461363-233461385 ATCCATCTGCACGCCAGGGCTGG - Intronic
948659340 2:239497554-239497576 GGCCATCAGGACGCAGGGGCAGG - Intergenic
948694334 2:239725637-239725659 GTCCACACGCACGCCGGTGCTGG - Intergenic
1169664510 20:8019460-8019482 CTCCAACTGGACGCTGGTGATGG - Exonic
1176213004 20:63934419-63934441 GTCCCTTTGGACGCCGCTGCTGG + Exonic
1181102265 22:20549451-20549473 GTCCATCTGGATGGGGGTGGGGG + Intronic
1184225650 22:43127720-43127742 GTCCATCTCGTCCCCGATGCAGG - Exonic
949227355 3:1710864-1710886 CCCCATCTGGACGCTGTTGCAGG - Intergenic
961213780 3:125144429-125144451 GTCCCTCTGGACCCCTCTGCAGG - Intronic
967106014 3:186255590-186255612 CTCCATCTGGACTCAGGTCCCGG - Intronic
968312145 3:197692808-197692830 CTCCATCTGGAGGCCTGTGCAGG + Intronic
968701462 4:2059942-2059964 GTCCGCGTGGACGCCGGGGCGGG - Intronic
981047817 4:140281628-140281650 ATCCAGCTGGAAGCAGGTGCTGG + Intronic
999433569 5:151544526-151544548 GTCCCTCTGGACTCCGGGCCTGG + Exonic
1011204713 6:84879175-84879197 GTACATCTGGGTGCCAGTGCTGG - Intergenic
1018182910 6:161240280-161240302 GTCCACCTGGAAGCCTGGGCTGG + Intronic
1020010547 7:4803687-4803709 GTCCACCTGGAAGCCGTCGCTGG + Exonic
1020125734 7:5531585-5531607 GACCATCTGGAGGCCGCTGGGGG + Intronic
1020256322 7:6504608-6504630 TCCCATCTGGGCGCGGGTGCTGG - Intronic
1026475093 7:70728413-70728435 GTCCATCTGGAGGCCGGGCATGG + Intronic
1042560924 8:70071595-70071617 GGCCTTCTGGACTCCGGTTCAGG - Intronic
1060895876 9:127216954-127216976 GACCACCTGGAGGGCGGTGCGGG + Intronic
1061986769 9:134134778-134134800 GTCCACCTGGCCGCCTGGGCCGG - Intergenic
1062554411 9:137107470-137107492 GTCCATCAGGAGGAGGGTGCTGG + Intronic