ID: 1161489913

View in Genome Browser
Species Human (GRCh38)
Location 19:4556184-4556206
Sequence GTCTGTTGTGGGCATGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161489903_1161489913 8 Left 1161489903 19:4556153-4556175 CCAGAACCTGAGTTGTGTGGGTG 0: 1
1: 0
2: 1
3: 12
4: 165
Right 1161489913 19:4556184-4556206 GTCTGTTGTGGGCATGGCCAAGG 0: 1
1: 1
2: 0
3: 22
4: 245
1161489907_1161489913 2 Left 1161489907 19:4556159-4556181 CCTGAGTTGTGTGGGTGGAGGGC 0: 1
1: 0
2: 1
3: 17
4: 192
Right 1161489913 19:4556184-4556206 GTCTGTTGTGGGCATGGCCAAGG 0: 1
1: 1
2: 0
3: 22
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161489913 Original CRISPR GTCTGTTGTGGGCATGGCCA AGG Intronic
902467778 1:16628780-16628802 GTCTGCTATGGGCAGGGTCAGGG - Intergenic
902548076 1:17202737-17202759 GCCAGTTGTGGGCAGGGCCAGGG - Intergenic
902674482 1:17999301-17999323 GTCTGCTGTGGCAATGGTCATGG + Intergenic
902709320 1:18227821-18227843 GGCTGATGAGGGCAGGGCCAGGG - Intronic
903174175 1:21570736-21570758 CTCTACTGTGTGCATGGCCAGGG + Intronic
904201885 1:28825238-28825260 GTCTTTTGAGTCCATGGCCAAGG + Intronic
905823796 1:41014547-41014569 GTCTGCTGTGGATGTGGCCAGGG + Intergenic
906790931 1:48658353-48658375 CTCTGTAGTGGGAAGGGCCAAGG + Intronic
907855392 1:58298699-58298721 CTCTGATGGGGGCATGGCCCAGG + Intronic
908024878 1:59939845-59939867 GTCTGTGGTGGCGGTGGCCATGG - Intergenic
909084456 1:71154942-71154964 GTCTGGTGTGGTGGTGGCCATGG - Intergenic
909368235 1:74854181-74854203 GTCTGTTTTGGGGAGGGGCAGGG - Intergenic
910208847 1:84774122-84774144 GTCTGCTGTGGGCAGGGGCTGGG + Intergenic
911536463 1:99106162-99106184 GTCTGTTGTGGCAGTGGCCATGG + Intergenic
917713536 1:177711125-177711147 GTGTGGAGGGGGCATGGCCATGG + Intergenic
918202714 1:182282083-182282105 GTCAGTTGAGAGGATGGCCAGGG + Intergenic
918388572 1:184036307-184036329 GTCTGCTGCGGGGAGGGCCAGGG - Intronic
918617322 1:186560342-186560364 GTATCTAGTGGGCAGGGCCAAGG + Intergenic
920044082 1:203122310-203122332 GTGTGTTCTGGGCAAGACCAGGG - Intronic
921752452 1:218811668-218811690 GTGTGTTTTGGGAATGGCAAGGG + Intergenic
922470197 1:225871950-225871972 CCCAGTTGTGGTCATGGCCAGGG - Intronic
922731815 1:227952494-227952516 GTCTTGTGTGGGCATAGTCAGGG - Intergenic
924041300 1:239986291-239986313 GTCAGGTGTGGGGATGGCCACGG + Intergenic
1063554988 10:7069868-7069890 GACAGTTGTGGCCATAGCCAAGG + Intergenic
1066422764 10:35277772-35277794 GTATGTTGCGGGCTGGGCCATGG + Intronic
1066649668 10:37642627-37642649 GCCTGTGGTGGCCATGACCATGG - Intergenic
1067021053 10:42798333-42798355 GTCTGTGGTGGGTATGGCAATGG - Intronic
1067032555 10:42888173-42888195 GCCTGTGGTGGCCATGACCATGG - Intergenic
1067405216 10:46016471-46016493 GGCTGATTTGAGCATGGCCAAGG - Intronic
1067710737 10:48649308-48649330 GTCTGCTCTGGGAAAGGCCAAGG + Intronic
1070226726 10:74515812-74515834 CTCTGTTGGTGGTATGGCCATGG + Intronic
1070576242 10:77681211-77681233 GCCTGTTGTGTGCATGGCCCCGG + Intergenic
1071301108 10:84256826-84256848 GTCTCTGGTGGGCATCGCCAAGG + Intronic
1073436816 10:103522009-103522031 TTCTCTTGTGGGCAGGGGCAGGG + Intronic
1075411526 10:122231995-122232017 CTCTCTTTTGGGTATGGCCAAGG - Intronic
1075464927 10:122644192-122644214 CTGTGTTGTGGGCATGGACGAGG + Intergenic
1075562014 10:123474845-123474867 GGCTGCTGTTGGCATGGCCATGG + Intergenic
1075811449 10:125227604-125227626 GACCTTTGTGGGCTTGGCCAAGG + Intergenic
1076674693 10:132141910-132141932 GTCTCTCCAGGGCATGGCCAAGG + Exonic
1077234238 11:1472246-1472268 GGCCGCTGTGGGCATGGCCTTGG - Intronic
1078402133 11:11037812-11037834 GTGGGTTGTGAGCATGGCTAAGG - Intergenic
1079007351 11:16801312-16801334 GTCTGTTGTGGTACAGGCCAGGG - Intronic
1079124296 11:17707991-17708013 GGCTGTTGCAGGCAGGGCCAGGG - Intergenic
1081864179 11:46350662-46350684 GTCTGCTGTGGGCTTGGCAGGGG + Intronic
1083487868 11:62994958-62994980 GTCTGACGTGGGCATGGTCCAGG + Intronic
1083749875 11:64755036-64755058 GTGTGTTGTGGGTGTCGCCAGGG + Intronic
1085432783 11:76469226-76469248 GTCTGTCATGGGCAAGGGCAAGG - Intronic
1085570671 11:77555503-77555525 TTCTCTTGTGGGCAGGGGCAGGG - Intronic
1085758723 11:79223641-79223663 GTCTGGGGTGAGAATGGCCAGGG - Intronic
1086750025 11:90480904-90480926 GTCTGTAGCAGGTATGGCCAAGG - Intergenic
1086750031 11:90480927-90480949 GTCTGTTGCCGGTATTGCCAAGG - Intergenic
1087416693 11:97865212-97865234 TTCTCTTCTGGGCATGTCCAAGG - Intergenic
1087840165 11:102912194-102912216 TTCTCTTGTGGGCAGGGGCAGGG - Intergenic
1088501965 11:110491836-110491858 GTCTGGTGGGGGCAGTGCCAGGG - Intergenic
1090650730 11:128803673-128803695 CTGTATTGTGTGCATGGCCAGGG - Intronic
1093303092 12:17478282-17478304 TTCTCTTGTGGGCAGGGGCAGGG - Intergenic
1094525660 12:31229158-31229180 GGTTGTTTTGGGCATGGCCCAGG - Intergenic
1098208475 12:68137240-68137262 GACTGTTGTAGGCAGGGCCCAGG - Intergenic
1100390334 12:94141535-94141557 GTCTCTTGGGGCCATGGCCCGGG + Intergenic
1100602121 12:96120915-96120937 GCCTTTTGTTGTCATGGCCATGG + Intergenic
1102412094 12:112728891-112728913 GTCTTTTCTGGGAATGGGCAGGG + Intronic
1102761299 12:115387773-115387795 CTTTGATGTGGGCATGGTCAGGG - Intergenic
1103875185 12:124121633-124121655 GTCTGTAGTGGACACTGCCAGGG + Intronic
1107332108 13:39312201-39312223 GCCTCTTGTGGACCTGGCCATGG - Intergenic
1108363173 13:49686176-49686198 GTCTGATGTGTGCTTGGCCATGG - Intronic
1110510887 13:76348760-76348782 GTATGTTGTGGACATTGCTATGG - Intergenic
1112486131 13:99821507-99821529 GTCTGTGAAGGGCATAGCCAAGG + Intronic
1118473296 14:66094422-66094444 ATTTGTTGTGGGGCTGGCCAGGG - Intergenic
1119775443 14:77245250-77245272 GTCTGTGCTGGGCATGGGAAGGG - Intronic
1121113519 14:91328463-91328485 GTCACTTGTGGTCAGGGCCACGG - Intronic
1121982419 14:98466460-98466482 GTCTGTTCTTGAGATGGCCATGG + Intergenic
1122691044 14:103532319-103532341 GTCTGTTGTGGGCACAGGCGAGG - Intronic
1124019401 15:25905326-25905348 GTGGGCTGTGGCCATGGCCAGGG - Intergenic
1124155977 15:27225654-27225676 GGCTATTGAGGGCATGGCCCAGG + Intronic
1124611045 15:31208836-31208858 GTCTGTTGTGGGGATCACCAGGG - Intergenic
1126727838 15:51651031-51651053 GCCTGTTCTAGGCATGGCAAAGG - Intergenic
1127841305 15:62834532-62834554 GTCTTTTGTGAGCTTAGCCATGG + Intronic
1128050022 15:64655888-64655910 GTCTGTAGGGGGCAGGGGCATGG + Intronic
1130091683 15:80826455-80826477 GTCTTTTGTGGTCATAGCAAGGG + Intronic
1131480792 15:92779896-92779918 TTCTCTTGTGGGCAGGGGCAGGG + Intronic
1132941391 16:2510191-2510213 CTCTGGGGTGGGGATGGCCAGGG - Intronic
1133161927 16:3917597-3917619 GTCTCTCGTGGGCAAGGCCAGGG - Intergenic
1133276289 16:4640249-4640271 GGCTGTCTTGGGGATGGCCAGGG - Intronic
1133411415 16:5572340-5572362 GTCTGCTGTGTTCATTGCCATGG - Intergenic
1134671664 16:16060268-16060290 GTCTGCTGTGGGCATGAGGAAGG - Intronic
1138541178 16:57688786-57688808 GTCTGTTGCTGGCATAGCCCTGG + Exonic
1138778565 16:59755064-59755086 CTCTGTTGTGGGCGTGGACGAGG - Intergenic
1139791774 16:69443362-69443384 GGTTTCTGTGGGCATGGCCATGG + Intronic
1140849418 16:78920825-78920847 GGCTGTTGTGAGGAAGGCCAGGG + Intronic
1141570544 16:84931007-84931029 GCATGGTGTGGGCATGGGCATGG + Intergenic
1142432709 16:90038887-90038909 GTCTGTGGTGTGCGGGGCCAGGG + Intronic
1142813154 17:2405624-2405646 GTATGCTGTGGCCAAGGCCAGGG + Intronic
1144055061 17:11533320-11533342 GGCTGTTGACGGCATGGCAAGGG - Intronic
1145267906 17:21389328-21389350 GTGTGCTGGGGGCATGGGCAGGG + Intronic
1145882975 17:28365200-28365222 GTCTGGTGTGGGCACAGCCCTGG - Exonic
1145896494 17:28461161-28461183 GTGGGGTGGGGGCATGGCCAGGG - Intronic
1146751840 17:35389183-35389205 ATTTGTAGTGGTCATGGCCAAGG + Intergenic
1147625744 17:41898711-41898733 GGCCATTGTGGGCATGGCCCTGG - Exonic
1148339803 17:46866674-46866696 GCCTGTAGTTGGCATGGCCCTGG + Intronic
1149221187 17:54416602-54416624 ATCTCTTGTGGGCAGGGGCAGGG - Intergenic
1151829784 17:76542802-76542824 GCCTGTTGTGGTCCGGGCCATGG + Intronic
1152218756 17:79049438-79049460 GTCTGGGGTGGCCATGGGCAGGG - Exonic
1152410077 17:80118718-80118740 GACTGTCCTGGGCGTGGCCACGG + Intergenic
1152586671 17:81192439-81192461 GGCTGTGCTGGGCCTGGCCAGGG - Intronic
1154310661 18:13264033-13264055 GTCTGTTGGGGGCATGGGAGGGG + Intronic
1156413227 18:36857151-36857173 GTCTTTTCTGAGCATGGCTATGG + Intronic
1157022607 18:43805063-43805085 GTCTGTTGTGGTGGTGGCCATGG - Intergenic
1158431334 18:57389969-57389991 GCCTGTGGTGGTGATGGCCATGG + Intergenic
1161489913 19:4556184-4556206 GTCTGTTGTGGGCATGGCCAAGG + Intronic
1162571137 19:11473955-11473977 GTCTGTCATGGGCATGATCATGG + Intronic
1162672277 19:12266976-12266998 GGCTGTTGGTGGCATGGCGAAGG + Intronic
1163226301 19:15963827-15963849 GACTGCTGTGGGGATGGCAAGGG - Intergenic
1164052485 19:21595133-21595155 GTCTCCTGTGGGCAGGGCCTAGG - Intergenic
1164052720 19:21596860-21596882 CCCTTTTGTGGGCATGGCCCAGG - Intergenic
1164181078 19:22819349-22819371 CCCTTTTGTGGGCATGGCCCAGG - Intergenic
1164311413 19:24049569-24049591 GTCTTCTGTGGGCAGTGCCAAGG - Intronic
1164312675 19:24059895-24059917 GCCTCCTGTGGGCAGGGCCAAGG - Intronic
1164314226 19:24072554-24072576 GCCTCTTGTGGGCAGGGCCCAGG - Intronic
1164642807 19:29838888-29838910 GACTGCTGTGGGCATTGCCAGGG - Intergenic
1164676590 19:30105332-30105354 CTGTGTTGTGGCCATGGCCATGG + Intergenic
1165320215 19:35080392-35080414 GTTTGATGTGGACATGGCCCCGG + Intergenic
1165570624 19:36772051-36772073 TTCTTTTGTGGGCATGTACACGG - Intronic
1166047561 19:40238392-40238414 GTCTGATCTGGGCTTGCCCATGG - Intronic
1166224096 19:41384167-41384189 GGCTGTGGTGGGCATCCCCAGGG + Intronic
1166334253 19:42095908-42095930 GGGTGATGTGGGCCTGGCCATGG - Exonic
1167159322 19:47756854-47756876 GCCTCTTCTGGGCATGGCCAAGG - Intronic
1167425234 19:49426780-49426802 GTTAGTTTTGGGCATGTCCAGGG - Exonic
925048189 2:790215-790237 GTCTTTTCTGGGCCTGCCCATGG + Intergenic
925295243 2:2772174-2772196 GCTTGTTGTGGGCAGGGCTATGG - Intergenic
929115365 2:38439420-38439442 GAGTGTTGTGGGCAAGGTCATGG - Intergenic
929828396 2:45328416-45328438 GTCATTTCTGGGCATTGCCATGG + Intergenic
932814304 2:74849559-74849581 TTCTGTGATGGGCATGGACAAGG - Intronic
933647141 2:84822009-84822031 GGCTGTGGTGGGAATGCCCACGG + Exonic
934142131 2:89056766-89056788 TTCTCTTGTGGGCAGGGTCAGGG - Intergenic
934227110 2:90143780-90143802 TTCTCTTGTGGGCAGGGTCAGGG + Intergenic
935260301 2:101350016-101350038 TTCTGTTGAGGGCCTGGCCCAGG + Exonic
936871103 2:117134878-117134900 TTCTCTTGTGGGCAGGGGCAGGG - Intergenic
938288846 2:130138894-130138916 GGGTGGTGCGGGCATGGCCACGG + Intergenic
938365069 2:130727766-130727788 GGCTGTGGTGGGCGTGGCCCCGG + Intergenic
938795338 2:134714114-134714136 GGCAGTTGTGGGCATTGCCTGGG - Intronic
940726962 2:157345247-157345269 TTCTCTTGTGGGCAGGGGCAGGG - Intergenic
940920319 2:159298428-159298450 TTCTGTTGTGGGCAGGGGCGGGG - Intergenic
942227859 2:173832332-173832354 GCCTGCTGCGGGCATAGCCAGGG - Intergenic
944272579 2:197800205-197800227 GTCTGTATTGTGCATGGCAAAGG - Intergenic
946141867 2:217698353-217698375 ATGGTTTGTGGGCATGGCCATGG - Intronic
947516598 2:230810756-230810778 CTCCTTTGTGGCCATGGCCAAGG + Intronic
948425402 2:237884104-237884126 GTCTGTTGTGAGCAAGGCTTGGG + Intronic
948485183 2:238276237-238276259 GTCTATTGTGGGTGAGGCCAGGG - Intronic
1168839645 20:901401-901423 TTCTCTTGTGGGCAGGGGCAGGG - Intronic
1169404906 20:5315132-5315154 ATCTGTTGAGTGCATGACCAGGG + Intergenic
1170599994 20:17834622-17834644 GTCAGTTGTGGGGCTGGGCAAGG - Intergenic
1170843888 20:19946102-19946124 GTCTGCTTTAGGCATGACCAGGG - Intronic
1171293095 20:23993843-23993865 GGCTGATGTGGGCATTGCCGAGG + Intergenic
1171973144 20:31577083-31577105 GTCTGAGGTGGGCAGGCCCATGG - Intronic
1176237105 20:64058457-64058479 GTCTTGTGTGGCCATGCCCAGGG + Intronic
1177692851 21:24532883-24532905 GTCTGTTGTGTGTATTGCCAGGG - Intergenic
1177726303 21:24972530-24972552 GTCTGATGTGGATATGGACATGG - Intergenic
1179638833 21:42733249-42733271 CCCTGCTGTGGGCATGGGCAAGG - Intronic
1180109944 21:45643090-45643112 GCCTGTGGTGGGCAGGGCCGTGG - Intergenic
1180954899 22:19737171-19737193 GTGTGATGTGGGCAGGGCCATGG - Intergenic
1181124584 22:20694713-20694735 GGCTGATGTGGGCATTGCCGAGG + Intergenic
1181398891 22:22639387-22639409 GGCTGATGTGGGCATTGCCGAGG - Intergenic
1181650530 22:24256672-24256694 GGCTGATGTGGGCATTGCCGAGG + Intergenic
1181706851 22:24654066-24654088 GGCTGATGTGGGCATTGCCGAGG - Intergenic
1183636458 22:39066273-39066295 TTCTCTTGTGGGCAGGGGCAGGG + Intronic
1185156285 22:49195378-49195400 GTGTGGAGTGGACATGGCCAAGG + Intergenic
952446154 3:33382971-33382993 GTTTGTTGTGTGCAAGGCCCAGG - Intronic
953194083 3:40715498-40715520 ATCTGTGGTGGGCAGGGCCTCGG - Intergenic
954317938 3:49811422-49811444 GACTGTGGTGGGCCTGGCCCGGG - Exonic
954382662 3:50227751-50227773 GGCTGCGGTGGGCAGGGCCAAGG + Intronic
954646022 3:52131974-52131996 TTCTGTTGTGGACATGGTCCTGG - Intronic
954761149 3:52875366-52875388 TTCTGTGGTGGGGCTGGCCAGGG - Intronic
955237270 3:57150371-57150393 GACTGCTGGGGGCATGGGCAGGG + Intronic
957394569 3:79621242-79621264 TTCTGTTGTGGGCAGGGGCAGGG - Intronic
959738217 3:109685402-109685424 TCCTTTTGTGGGCATGGGCATGG + Intergenic
962373187 3:134838089-134838111 GTGTGTTGGGGGCTTGGGCATGG - Intronic
962643280 3:137410704-137410726 GCCTGCTGTGGGCGTGGCCCAGG - Intergenic
966863732 3:184244760-184244782 GGGTGTTGTGTGCATGGCCCTGG - Intronic
967245523 3:187482845-187482867 CTCTGTGGTGGGAATGACCATGG - Intergenic
969552030 4:7876240-7876262 GTTTGTCGTGGCCCTGGCCAAGG + Intronic
969584088 4:8082059-8082081 GTGTGTTGGGGGCATGACAAGGG + Intronic
971980812 4:33747629-33747651 TTCTCTTGTGGGCAGGGCCGGGG + Intergenic
973553924 4:52062946-52062968 GCATGTTGTGGGCAGAGCCAGGG + Intronic
974782768 4:66575022-66575044 TTCTTTTGTGGGCATGGGCACGG + Intergenic
976444154 4:85110786-85110808 GCCTGTTGTGGTGGTGGCCATGG + Intergenic
978631665 4:110754144-110754166 GTCTGTTTTGTTCATTGCCATGG - Intergenic
982263035 4:153512130-153512152 ATCGGTTGTGGGGATGGCTATGG + Intronic
985409188 4:189665052-189665074 GTCTGCTGTGGGCGTGGGCTTGG - Intergenic
986160305 5:5221437-5221459 GTGTGTTGTGTTAATGGCCAGGG - Intronic
986254692 5:6092316-6092338 TTCTCTTGTGGGCAGGGGCAGGG + Intergenic
987911741 5:24155455-24155477 GTCCGTGGTGGCCGTGGCCATGG + Intronic
988069831 5:26273785-26273807 GTCTATTGCAGGCATGCCCAGGG - Intergenic
988499364 5:31771542-31771564 GTCTGCTGTTGGATTGGCCAGGG + Intronic
990007497 5:50960868-50960890 GTCAGTTGTGGGCAGGGAGAAGG + Intergenic
990982683 5:61615883-61615905 CACTGATGTGGGCATGGCCATGG + Intergenic
992357097 5:75997262-75997284 TTCTGATGTAGGCATGGGCAAGG + Intergenic
993180845 5:84549964-84549986 GTCTGTTGTTGGCTTGGAGATGG + Intergenic
995894630 5:116998035-116998057 GTCTGTAGCAGACATGGCCAGGG + Intergenic
996350609 5:122537170-122537192 GTTTTTAGTGGGCATGACCACGG - Intergenic
998484961 5:142493895-142493917 GTCTGTTAAGGGCATGTCCTTGG - Intergenic
999440384 5:151595948-151595970 CTCTGATGTGGCCATGGCCCAGG + Intergenic
999697421 5:154199238-154199260 GGCTGGTTTGGGCTTGGCCAAGG + Intronic
999763218 5:154718823-154718845 GTCTGTTGTGGGCATGGCAAGGG + Intronic
1001768581 5:174275106-174275128 TTCTGTTGGGGGCAGGTCCAGGG + Intergenic
1001950350 5:175812253-175812275 TTCTGTGGTGGGCAGGGCCTGGG - Intronic
1003850837 6:10220858-10220880 CTCTGTTCCAGGCATGGCCAGGG - Intergenic
1005053067 6:21703014-21703036 GTCTGTGGTGGGCAGGAACATGG + Intergenic
1005585463 6:27272644-27272666 CTCTGTTGTGGGGAAGGACAGGG + Intergenic
1007266198 6:40598079-40598101 GTCAGTTGTGGGGATGGGGAAGG - Intergenic
1007375651 6:41454928-41454950 ATTTGATGTGGGCATGGCCCTGG - Intergenic
1009266463 6:61561615-61561637 GTCTGTTGTGGGGGTGACCATGG - Intergenic
1012475122 6:99608685-99608707 TTGGGTTGTGGGCCTGGCCAAGG + Intronic
1014458610 6:121667898-121667920 GTTTTCTGTGGGCATGGGCATGG + Intergenic
1014993223 6:128108028-128108050 GTTTGTTTTTGGCATGGCCTGGG - Intronic
1017916556 6:158836116-158836138 GTGTGCAGAGGGCATGGCCAGGG + Intergenic
1018630289 6:165816431-165816453 GTCTGTTGAGAGAAAGGCCACGG + Intronic
1018694777 6:166382873-166382895 GTCTGGTGTCGGCACAGCCATGG - Exonic
1019538592 7:1541348-1541370 GTCTTTTGGGGGCCTGGCGAGGG + Exonic
1020016626 7:4835364-4835386 TTCTGGTGTGGGGGTGGCCAGGG - Intronic
1024169525 7:46769477-46769499 TTCTCTTGTGGGCAGGGGCAGGG - Intergenic
1025223884 7:57139934-57139956 GCCCCTTGTGGGCAGGGCCAAGG - Intergenic
1025749969 7:64285124-64285146 GCCTCTTGTGGGCAGGGCCCAGG + Intergenic
1025782942 7:64617863-64617885 GTCCCTTGTGGGCAGGGCCCAGG - Intergenic
1025785438 7:64639553-64639575 GTCTTCTGAGGGCAGGGCCAAGG - Intergenic
1025787648 7:64658271-64658293 TTATTTTGTGGGCATGGCCCAGG - Intergenic
1029589246 7:101496248-101496270 GTCGGCTGTGGCCAGGGCCATGG + Intronic
1031594037 7:123627021-123627043 GCCTGTTGTGGGGCTGGGCATGG - Intronic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1033655385 7:143370131-143370153 CTGTGTTGGGGGCAGGGCCAAGG + Intergenic
1033943786 7:146688515-146688537 TTCTCTTGTGGGCAGGGGCAGGG + Intronic
1034475324 7:151278101-151278123 CTCTGTTATGGGCAGGCCCAAGG + Intergenic
1035974431 8:4292113-4292135 CTTTGTTGTTGGTATGGCCAGGG - Intronic
1037615166 8:20512553-20512575 CTCTCTTGTTGGCATGCCCAAGG - Intergenic
1038992270 8:32880820-32880842 GTTTGCTGTGGGTTTGGCCAGGG - Intergenic
1041493979 8:58465821-58465843 TTCTCTTGTGGGCAGGGGCAGGG - Intergenic
1041986311 8:63925365-63925387 GGCTGATCTGGGTATGGCCACGG + Intergenic
1042297989 8:67242893-67242915 GCCTGTGGTGGTGATGGCCACGG + Intronic
1043528576 8:81124134-81124156 GTCTTTTGTGAAGATGGCCAAGG + Intergenic
1045815721 8:106273490-106273512 GTGTCTTGTGGGCCAGGCCAGGG + Intronic
1046557340 8:115790973-115790995 GTCTGTTGTAGTGGTGGCCACGG + Intronic
1046841802 8:118866907-118866929 ATCTGTTAAGGGCATGACCAAGG - Intergenic
1047009636 8:120657490-120657512 GTTTGCTGTGGGCATGGAAATGG + Intronic
1048566597 8:135606215-135606237 GTCTTTTCTGGGCATGGATATGG + Intronic
1049806809 8:144544810-144544832 GTCTCTTCTGGGCATGGTCCTGG - Intronic
1051460965 9:17314652-17314674 TTCTGTTGTGGGCCTTGCTAAGG + Intronic
1051966604 9:22836040-22836062 GTCTGTGGTGGTAGTGGCCAGGG - Intergenic
1053015117 9:34657440-34657462 GGATCCTGTGGGCATGGCCAGGG - Exonic
1057055830 9:91959939-91959961 GGTTGTTGTGGACATGGGCATGG + Intergenic
1059249977 9:112879707-112879729 GTCTTCTGGGGGCCTGGCCATGG + Exonic
1060105890 9:120873299-120873321 GTCTGTTGTGTGTATGGGAAGGG + Intronic
1060572034 9:124650933-124650955 GCCTTTTGGGGGCATTGCCAGGG - Intronic
1061618082 9:131793154-131793176 GGCTGCAGTGGGCATGGCTAGGG - Intergenic
1187636865 X:21238665-21238687 GTCTGTGGTGGTGGTGGCCATGG + Intergenic
1188063870 X:25633649-25633671 GGCTGTTGTAGGCAGGGGCAGGG - Intergenic
1188413085 X:29898284-29898306 AGCTGCCGTGGGCATGGCCACGG + Intronic
1191184244 X:57592605-57592627 GTGTGGTGGGGGCGTGGCCAGGG - Exonic
1191213149 X:57909854-57909876 GTGTGGTGGGGGCGTGGCCAGGG + Exonic
1192062210 X:67839111-67839133 GACTGTAGTGGTGATGGCCATGG + Intergenic
1192075055 X:67985512-67985534 TTCTCTTGTGGGCAGGGGCAGGG + Intergenic
1192658266 X:73015226-73015248 GGCTGTAGTGAGCATGTCCAAGG + Intergenic
1194358629 X:92919181-92919203 CTCTGTTCTGGGCATGGGCAAGG + Intergenic
1194435936 X:93868591-93868613 TCCTTTTGTGGGCATGGGCACGG - Intergenic
1196979630 X:121197198-121197220 TCCTTTTGTGGGCATGGGCACGG + Intergenic
1198880948 X:141280487-141280509 GTCAGTTGAGGGCATGAGCAGGG - Intergenic
1200666806 Y:6034871-6034893 CTCTGTTCTGGGCATGGGCAAGG + Intergenic
1200889787 Y:8311327-8311349 ATCTCTTGTTGGCAGGGCCAGGG - Intergenic
1201377889 Y:13342012-13342034 CTCTGTTGTGGGGATGGTAAGGG - Intronic
1201422776 Y:13818547-13818569 TTCTCTTGTGGCCATGTCCAGGG - Intergenic
1201896395 Y:18997181-18997203 CTCTGTTGTGGGGATGGTAAGGG - Intergenic