ID: 1161490492

View in Genome Browser
Species Human (GRCh38)
Location 19:4558349-4558371
Sequence GGAGCCGCCGCCGCTTAGCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161490492_1161490505 29 Left 1161490492 19:4558349-4558371 CCACGCTAAGCGGCGGCGGCTCC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1161490505 19:4558401-4558423 TAGCAGCAGCAGAAGCAGCAGGG 0: 1
1: 5
2: 53
3: 201
4: 852
1161490492_1161490496 -4 Left 1161490492 19:4558349-4558371 CCACGCTAAGCGGCGGCGGCTCC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1161490496 19:4558368-4558390 CTCCTCAGGAAAGAGGCCGTGGG 0: 1
1: 0
2: 0
3: 13
4: 146
1161490492_1161490504 28 Left 1161490492 19:4558349-4558371 CCACGCTAAGCGGCGGCGGCTCC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1161490504 19:4558400-4558422 GTAGCAGCAGCAGAAGCAGCAGG 0: 1
1: 5
2: 124
3: 316
4: 1244
1161490492_1161490495 -5 Left 1161490492 19:4558349-4558371 CCACGCTAAGCGGCGGCGGCTCC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1161490495 19:4558367-4558389 GCTCCTCAGGAAAGAGGCCGTGG 0: 1
1: 0
2: 1
3: 39
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161490492 Original CRISPR GGAGCCGCCGCCGCTTAGCG TGG (reversed) Exonic
900326868 1:2112525-2112547 GGTGCAGCCGCCGCTTGGAGCGG + Intronic
900578035 1:3393995-3394017 GGAGCCGCCGCCGCCGCGGGAGG - Intronic
905862624 1:41361436-41361458 GGTGCAGCCGGCGCTGAGCGCGG + Intergenic
907444567 1:54499519-54499541 GCAGCCGCCGCCGCTCGGCGAGG - Intergenic
915214134 1:154328879-154328901 GGAGCCGCAGCCGCTCAGAGGGG - Intronic
921155065 1:212432952-212432974 GCAGCCGCCGCCGCGGCGCGGGG - Exonic
923163414 1:231337387-231337409 GGAGCCGCCGCCGCCTCTGGAGG - Exonic
923630857 1:235649115-235649137 GGAGCCACCGCAGCTGAGGGTGG - Intronic
1064977437 10:21133346-21133368 GGAGCCCCCTCCGCTAAGCCTGG - Intronic
1066994753 10:42553214-42553236 GGTGCCGCCGCGGCGCAGCGGGG - Intergenic
1070570646 10:77637747-77637769 GCCGCCGCCGCCGCGGAGCGCGG + Intronic
1072809356 10:98446987-98447009 GGAGCCGCCGTCGCCTTCCGCGG + Intergenic
1077008433 11:369688-369710 GGGGCCGCGGGCGCTGAGCGCGG + Intergenic
1084707608 11:70824410-70824432 GGAGCCCCGGCTGCTTAGCAGGG - Intronic
1097102447 12:56599166-56599188 AGAGTCGCCGCCGCTTGGAGGGG + Exonic
1100444660 12:94650031-94650053 GGAGCGCCCGCCGCTCCGCGAGG - Intronic
1107898571 13:44989738-44989760 GGAGACGCCGCCGCTTACCAGGG - Exonic
1122666618 14:103334446-103334468 GGTGCCGCCGCCGAGCAGCGGGG - Exonic
1123032152 14:105456972-105456994 GGAGCCAGTGCCCCTTAGCGAGG + Intronic
1124790044 15:32718482-32718504 GCAGACGCGCCCGCTTAGCGAGG + Intronic
1127997669 15:64163053-64163075 GGAGCCGGCGCCGCCACGCGCGG + Exonic
1131056713 15:89379208-89379230 GGAGCCGCAGCCGCCGAGCCCGG + Intergenic
1132342364 15:101086579-101086601 GGATCTGCCGCCGCTCAGCCCGG + Intergenic
1134149882 16:11797236-11797258 GCTGCCGCCGCCGCTAACCGAGG - Intronic
1135354349 16:21757138-21757160 TGAGCCGCCGGCGCTGGGCGTGG - Exonic
1135452840 16:22573278-22573300 TGAGCCGCCGGCGCTGGGCGTGG - Intergenic
1143639734 17:8189258-8189280 GGAGCTGACGGCGCTGAGCGTGG - Exonic
1147393010 17:40121877-40121899 GGGGCCGCCGCCGCCTCGAGGGG - Intergenic
1151802078 17:76384617-76384639 GCAGCCGGCGCCGCGGAGCGGGG - Intronic
1152447386 17:80353754-80353776 GGAGTCGCCGCCGCTGTGCAGGG + Intronic
1152663177 17:81552361-81552383 GGAGCCGCCGCCGCGCGGCCGGG - Exonic
1152732143 17:81977654-81977676 GGAGCCTCCGCCGCCTGCCGGGG - Exonic
1152870752 17:82751883-82751905 GGAGCCGGGACCGCTCAGCGGGG - Intergenic
1154241560 18:12657963-12657985 GGAACCGCCGCCGCCCAACGCGG + Exonic
1154377934 18:13824149-13824171 AGAGCCGCAGCCGCCTAGCTGGG + Intronic
1161490492 19:4558349-4558371 GGAGCCGCCGCCGCTTAGCGTGG - Exonic
1162109016 19:8390331-8390353 GGAGCCGGCGCCGCGCAGAGCGG - Exonic
1166788838 19:45385623-45385645 GGTGGCGCCGTCGCTGAGCGTGG + Exonic
927652340 2:24920199-24920221 GGAGCCGCCGGCGCCGCGCGGGG - Intergenic
927856301 2:26529914-26529936 GGAGCCGCAGCCGCTGAATGAGG - Intronic
930136022 2:47905350-47905372 GGACCCGCCTCCGCTCAGCTTGG + Intronic
932880119 2:75493380-75493402 GGAGACACCGCCGCTTCGAGAGG - Exonic
934079059 2:88452306-88452328 GCAGCCGCCGCCGCGTACCTGGG - Exonic
944743668 2:202635348-202635370 GCCGCCGCCGCCGCTCCGCGTGG - Exonic
945673890 2:212832805-212832827 GGAGCCGGTGCCGCGTGGCGTGG - Intergenic
1171469785 20:25361105-25361127 GGTTCAGCAGCCGCTTAGCGTGG - Intronic
1180736831 22:18023803-18023825 GGAGCAGCGGCTGCTTTGCGCGG - Intronic
1185255155 22:49827637-49827659 GGAGCCGCCGCGGCCGAGAGGGG - Intergenic
1185335759 22:50270297-50270319 GGAGCAGCCGCCGCTCCGCCCGG + Exonic
950215323 3:11154590-11154612 GGGGCCGCCGCGGCTGGGCGAGG + Intronic
964482901 3:157160020-157160042 GGAGCCGCCCGCGCTTGGGGCGG + Exonic
968493286 4:901811-901833 GGCGCCGCTCCCGATTAGCGAGG + Intronic
968603331 4:1520610-1520632 GGGGTCGCCGCCGCGTAGGGAGG - Intergenic
969394233 4:6910095-6910117 GGAGCCGCGGCCGCGCGGCGAGG - Intronic
974654346 4:64799982-64800004 GGAGCCACCGCAGCTCAGCAAGG + Intergenic
984206500 4:176792875-176792897 GCCGCCGCCGCCGCTCAGCCCGG - Intergenic
989103356 5:37839775-37839797 GCAGCCGCCGCTGCTTTGGGTGG + Intergenic
992105783 5:73448197-73448219 GCCGCCGCCGCCGCTGCGCGGGG + Exonic
996065169 5:119071415-119071437 GGAGCCGGAGCCGCTCAGCTGGG - Intronic
996308565 5:122077870-122077892 GGAGCCGCCGGCGGCTCGCGCGG + Exonic
1003133989 6:3418832-3418854 GGAGGCACCGCCGTTTAGCAGGG + Intronic
1005320197 6:24646052-24646074 AGCGCCGCCGCCGCTCTGCGCGG + Exonic
1016714148 6:147204286-147204308 GAGGCCGCCGCTGCTTGGCGCGG - Intergenic
1017146598 6:151240636-151240658 GGGGCCGCCGCCGCTGGGCTCGG - Exonic
1017497626 6:154995532-154995554 GGAGCCGCCGCCAACCAGCGCGG - Intronic
1026471106 7:70694583-70694605 TGAGCCGCCGCCGCGGCGCGCGG - Intronic
1031927542 7:127652384-127652406 GGAGGAGCCGCCGCTCTGCGCGG - Exonic
1034830716 7:154305258-154305280 GAAGCTGCCGCTGCTTAGTGGGG - Exonic
1043388328 8:79768574-79768596 GGAGCCGCCGGCGCGCAGCCCGG - Intergenic
1050231172 9:3526751-3526773 GGTGCCGCCGCAGCGTGGCGCGG + Intergenic
1061725973 9:132582264-132582286 GCAGCCGCCGCCGCTCTCCGCGG + Exonic
1062513494 9:136920857-136920879 GGAGCCACCACCTCTTGGCGAGG + Intronic
1193715830 X:84934334-84934356 GGAGCGTCCGGCGCTTATCGTGG + Intergenic
1196707401 X:118727864-118727886 GAAGCCGCAGCCGCCGAGCGCGG - Intronic