ID: 1161492110

View in Genome Browser
Species Human (GRCh38)
Location 19:4567786-4567808
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 975
Summary {0: 2, 1: 14, 2: 42, 3: 127, 4: 790}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161492110_1161492117 -9 Left 1161492110 19:4567786-4567808 CCTCCATGGCTCCCACCTGCCTC 0: 2
1: 14
2: 42
3: 127
4: 790
Right 1161492117 19:4567800-4567822 ACCTGCCTCGGGGTCAAAGCCGG No data
1161492110_1161492120 -7 Left 1161492110 19:4567786-4567808 CCTCCATGGCTCCCACCTGCCTC 0: 2
1: 14
2: 42
3: 127
4: 790
Right 1161492120 19:4567802-4567824 CTGCCTCGGGGTCAAAGCCGGGG No data
1161492110_1161492119 -8 Left 1161492110 19:4567786-4567808 CCTCCATGGCTCCCACCTGCCTC 0: 2
1: 14
2: 42
3: 127
4: 790
Right 1161492119 19:4567801-4567823 CCTGCCTCGGGGTCAAAGCCGGG No data
1161492110_1161492123 14 Left 1161492110 19:4567786-4567808 CCTCCATGGCTCCCACCTGCCTC 0: 2
1: 14
2: 42
3: 127
4: 790
Right 1161492123 19:4567823-4567845 GGTCTTCCCTGCAGCCCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161492110 Original CRISPR GAGGCAGGTGGGAGCCATGG AGG (reversed) Intergenic
900305830 1:2007224-2007246 GAGGCTGCGGGGAGCCATGATGG - Intergenic
900552676 1:3264541-3264563 GAGGCAGGGGAGGGGCATGGAGG + Intronic
900641793 1:3691105-3691127 GAGGCAGGTCCCAGGCATGGAGG + Intronic
900686844 1:3954215-3954237 TAGGCAGATGTGTGCCATGGTGG + Intergenic
900780418 1:4614218-4614240 CAGGCACTGGGGAGCCATGGAGG + Intergenic
901269570 1:7941472-7941494 GAGGAAGGAGGGAGAAATGGAGG + Intronic
901323283 1:8352001-8352023 GAGGCAGATGGGGGCCAGGCAGG + Intergenic
901399746 1:9007569-9007591 GAGGCTGGAGGGAGCCCTGTGGG - Intronic
901517932 1:9761932-9761954 GAAACAGGTGGAAGCCAAGGCGG + Intronic
901639316 1:10685479-10685501 GAGGAAGGTGTGAGAAATGGGGG - Intronic
901641038 1:10693210-10693232 GAGGCAGGTGGGAGACAGTCCGG + Intronic
901659224 1:10788334-10788356 CAGGCAGGTGGGAGTAGTGGTGG + Intronic
901674378 1:10874434-10874456 TAGCCAGGTGGGACCCAGGGAGG + Intergenic
901677158 1:10892230-10892252 GGTGCCAGTGGGAGCCATGGAGG - Intergenic
901827154 1:11869720-11869742 GGGGCAGGAGGAAGCCAGGGTGG + Intergenic
901936003 1:12627560-12627582 TAGGCAGGAGGCAGGCATGGGGG - Intergenic
902210231 1:14899691-14899713 GAGGGAGGAGGGAGCTAGGGAGG - Intronic
902387183 1:16082693-16082715 GAGTGAGATGGGAGCTATGGTGG + Intergenic
902616087 1:17624305-17624327 GAGGCAGGTGTGGGCCAGGGAGG - Intronic
902630472 1:17701640-17701662 GAGGCAGCTGTGAGCCAGGCCGG + Intergenic
902649478 1:17827136-17827158 GAGCCAGGTGGGGGCCAGGGCGG + Intergenic
902699075 1:18159283-18159305 CAGGCAATAGGGAGCCATGGAGG + Intronic
902708739 1:18224366-18224388 AAGGAAGGTGTGAGCCATAGGGG - Intronic
902771670 1:18648756-18648778 AGGGCAGCGGGGAGCCATGGAGG + Intronic
903150865 1:21407621-21407643 GAGGCTGCAGTGAGCCATGGTGG - Intergenic
903268885 1:22175489-22175511 GAGGCAGTTGGCAGGCATGGGGG + Intergenic
903573840 1:24325632-24325654 GAGGCATGTTGGAGCCATGAAGG + Intronic
903577262 1:24346676-24346698 GAGGGAGGTGGGAGCTGGGGTGG - Intronic
903766812 1:25740359-25740381 CAGTCAGATGGGAGCCATGGGGG + Intronic
904197161 1:28794464-28794486 TGGGCAGGGGGCAGCCATGGTGG - Intergenic
904304962 1:29582718-29582740 GGAGAAGATGGGAGCCATGGAGG - Intergenic
904522086 1:31103311-31103333 GAGGCTGCAGGGAGCCATGATGG + Intergenic
904741035 1:32676020-32676042 GAGGCTGCTGTGAGACATGGTGG + Intronic
904891692 1:33784218-33784240 GGGGCAGTGGGGAGCCATGGAGG + Intronic
905308488 1:37034407-37034429 GGGGCAGGTGGGAGCCCGCGCGG - Intergenic
905370193 1:37478975-37478997 GGGGCAGCTGGGGGCCATGGAGG - Intronic
905548790 1:38819461-38819483 GGGGAAGGTGGGAGCCCGGGGGG + Intergenic
905973475 1:42157770-42157792 GTGGCAGTGTGGAGCCATGGAGG - Intergenic
906144758 1:43553412-43553434 GAGGAAGGTGGCAGTCATGGGGG - Intronic
906545931 1:46619440-46619462 GAGGCAGGTGGAAGGGTTGGGGG + Intergenic
906606322 1:47174862-47174884 CAGGCAGATGGGAGCCATCTGGG + Intergenic
906713816 1:47952310-47952332 GAGGCAGGAGGGAGCAAGGGAGG - Intronic
907278488 1:53329674-53329696 GACCCAGGTGAGAGCAATGGGGG + Intergenic
907301590 1:53490247-53490269 GAGGAAGGTGGGAGACAGGGTGG - Intergenic
907334652 1:53692307-53692329 CAGGCAGTGGGGAGCCATGGAGG - Intronic
907502069 1:54887867-54887889 GAGGCAGATGGGAGGCCCGGAGG + Intergenic
907765787 1:57409137-57409159 GAGGCAGGTGGAACCTTTGGAGG - Intronic
908094025 1:60718388-60718410 GAGGCACAAGGGAGACATGGGGG + Intergenic
908374498 1:63521690-63521712 GTGGCATGTGGGAGCCCAGGAGG + Intronic
908470253 1:64437162-64437184 GGGGCAGGCGGGGGGCATGGGGG + Intergenic
911161041 1:94683577-94683599 GGGGCAGGAGGCTGCCATGGTGG - Intergenic
912360812 1:109093425-109093447 GAGGCTGCAGTGAGCCATGGTGG + Intronic
912809100 1:112780311-112780333 GAAGCAAGTGGGAGCCGTGGAGG + Intergenic
913486465 1:119336231-119336253 GATGCAGGTGGTAGCCAAGGTGG - Intergenic
914521943 1:148425582-148425604 GAAGCTGGTGGGAGTCATGGCGG - Intergenic
914934977 1:151970787-151970809 GGGGCAGGTGGGGGGCATTGGGG + Intergenic
915101966 1:153507295-153507317 GTGGGAGGAGGGAGACATGGGGG - Intergenic
915165174 1:153944368-153944390 GAGTGAGGGGGGGGCCATGGCGG - Exonic
915450761 1:156003394-156003416 GAGGCAGGTTACAGCAATGGAGG + Intronic
915507351 1:156366296-156366318 CAGACAGGTGGGAGCCAGGGAGG + Intronic
915508527 1:156372631-156372653 GAGGCAGGCGGGATGGATGGTGG + Intronic
915593111 1:156881701-156881723 GGGGCTGCTGGGAGCTATGGGGG - Intronic
916463913 1:165054142-165054164 GAGGGAGTTGGGAGACCTGGTGG - Intergenic
916883949 1:169048798-169048820 GAGGCAGATGGGAGCGAAAGAGG + Intergenic
917678524 1:177342483-177342505 GAGGGAGATGTGAGCAATGGTGG - Intergenic
917775074 1:178324903-178324925 TTGGCAGGTGGGTGCCAAGGGGG - Intronic
918659094 1:187067320-187067342 GTGCCAGGTGGGAGGCAGGGTGG + Intergenic
918899977 1:190402794-190402816 GAGGCTGCAGGGAGCCATGATGG - Intronic
919097998 1:193059847-193059869 GATGCGGGTGAGAGACATGGAGG - Intronic
919168722 1:193927642-193927664 GCTGCAGGTGGGAGCTAAGGGGG - Intergenic
919432296 1:197510855-197510877 GAGGGAGGTGTTTGCCATGGAGG + Intronic
919745829 1:201008727-201008749 TGGGCAGGTGGGAGGCTTGGTGG - Intronic
920136216 1:203771332-203771354 GAGAGAGATGGGAGTCATGGCGG - Intronic
920220000 1:204389982-204390004 GTGGAAAGGGGGAGCCATGGAGG - Intergenic
920284412 1:204869136-204869158 GGGGCTGGAGGGAGCCAGGGTGG + Intronic
920546445 1:206822350-206822372 GAGGCTGGTGGGTGATATGGAGG + Intronic
920963228 1:210682212-210682234 TAGGCACTTGGGAGCCATGCTGG - Exonic
921063978 1:211609765-211609787 AAGGCAGGAAGGAGCCATTGGGG - Intergenic
921064400 1:211612441-211612463 GAGGCTGCTGTGAGCCATGATGG - Intergenic
921880735 1:220252089-220252111 GAGGCAGCAGTGAGCCATGATGG + Intronic
922726083 1:227923698-227923720 GACCAAGGTGGGAGGCATGGTGG - Intronic
922774012 1:228206857-228206879 GAGGGAGGAGGGAGCCAGGACGG - Intronic
922777595 1:228223403-228223425 GAGGCAGCTGGGAGCTGTGTGGG + Intronic
922917513 1:229270944-229270966 GCGGCAGGTGGGGGCGTTGGGGG - Intergenic
923721883 1:236473833-236473855 GAGGCTGCAGTGAGCCATGGTGG - Intronic
924501840 1:244645492-244645514 GAGGCGGGTGGGAGGGGTGGAGG - Intergenic
924623190 1:245679971-245679993 GAGCCAGGCGGGAGGGATGGAGG - Intronic
1063160764 10:3416428-3416450 GTGGGAGTTGGGAGCCATGGAGG + Intergenic
1063294214 10:4786520-4786542 AAGGCAGGTGGGAGGCATCACGG + Intergenic
1063371299 10:5524665-5524687 GCGGCAGGTGGGAGACGGGGAGG + Exonic
1063511734 10:6651533-6651555 GAGGCTGGAGTGAGCCATGATGG - Intergenic
1063881673 10:10538239-10538261 GAGGCAGGAAGGAGACATGGGGG - Intergenic
1063918533 10:10909019-10909041 GAGGCAGGTGGGATCACTTGAGG - Intergenic
1064102158 10:12473112-12473134 GCGCCAGGTGGAAGCAATGGTGG + Intronic
1064321487 10:14309659-14309681 GAGGCAGGAGGGGGGCCTGGAGG - Intronic
1065967123 10:30779483-30779505 GGTGAATGTGGGAGCCATGGGGG + Intergenic
1066155538 10:32672657-32672679 CAGGCCGTTGGGAACCATGGTGG + Intronic
1066358649 10:34709648-34709670 GGCGGAAGTGGGAGCCATGGAGG + Intronic
1067325623 10:45263558-45263580 CAGGCCACTGGGAGCCATGGTGG - Intergenic
1067476932 10:46573557-46573579 GGGGCAGGAGTGAGCCATGGAGG + Intergenic
1067549902 10:47226954-47226976 GAGGCTGGAGGCAGCCAGGGAGG + Intergenic
1067617806 10:47768224-47768246 GGGGCAGGAGTGAGCCATGGAGG - Intergenic
1067799602 10:49349938-49349960 GAGGAAGGATGCAGCCATGGTGG + Intergenic
1067838223 10:49654655-49654677 GAGGCAGGGAGGAGCCTTAGTGG - Intronic
1068678215 10:59790271-59790293 CAGGCAGGTGGGAGCAACAGGGG - Exonic
1069305609 10:66965137-66965159 AAGACAGCTGGGAGCCACGGTGG + Intronic
1069959599 10:72072111-72072133 TGGGGAGGTGGGAGCCCTGGAGG - Intronic
1070050611 10:72885890-72885912 GTGGAAGCTGGGAGCCATGTGGG + Exonic
1071682055 10:87716218-87716240 GAGGGTGGAGGGTGCCATGGAGG - Intronic
1072612539 10:97028254-97028276 GAGGCAGGAGTGAGCCCTGCTGG - Intronic
1075038591 10:119089592-119089614 GGACCAGGTGGTAGCCATGGAGG - Intergenic
1076250203 10:128979113-128979135 GACGAAGGTGGGACACATGGAGG + Intergenic
1076530648 10:131142206-131142228 GGGGCAGGTGGGATCCAGGTGGG + Intronic
1076625726 10:131820656-131820678 GAGGCAGGTGGAGGGAATGGGGG - Intergenic
1077094370 11:793072-793094 GAGGATGGTGGGAGCCGTGGAGG + Intronic
1077158826 11:1103489-1103511 GGGGACGGTGGGAGCCGTGGGGG - Intergenic
1077159344 11:1105635-1105657 GAGGCAGGAGGGAGGCAGGAGGG - Intergenic
1077224655 11:1434781-1434803 GGGGCATGTTGGAACCATGGGGG - Intronic
1077239334 11:1502463-1502485 GTGCCTGGTGGGAGTCATGGGGG - Intergenic
1077247225 11:1545558-1545580 TAGGCAGGTGGGCTCCGTGGAGG - Intergenic
1077283706 11:1756741-1756763 GCTGCAGGTGGGGGCCCTGGGGG + Intronic
1077321057 11:1942130-1942152 GAGGAAGGTGGGAGGGAGGGGGG + Intergenic
1077324690 11:1958687-1958709 GAGGCCTGTGGGAGACATGGGGG - Intronic
1077373585 11:2195006-2195028 GTGGCAGGTGGCAGGCATGCTGG + Intergenic
1077404121 11:2375210-2375232 GGGGCAGGTGTGAGCCTGGGAGG - Intergenic
1077418226 11:2435932-2435954 CAGGCAGCAGGTAGCCATGGGGG + Intergenic
1077490592 11:2859191-2859213 GAGCCACGTGGGCTCCATGGAGG + Intergenic
1077555822 11:3225561-3225583 GGGGCAGGTGGGAGCCTGGACGG + Intergenic
1077561272 11:3263273-3263295 GTGGGAGCTGGGATCCATGGAGG - Intergenic
1077567168 11:3309102-3309124 GTGGGAGCTGGGATCCATGGAGG - Intergenic
1078463858 11:11535779-11535801 GAGGAAGGTGGGAGCCTGGCAGG - Intronic
1081701776 11:45156981-45157003 GAGGCAGGTGAGGGCCAGGCCGG + Intronic
1081704137 11:45170837-45170859 GAGCAGGGTGGCAGCCATGGAGG + Intronic
1082122279 11:48392015-48392037 CAGGAAGGTTGGAGCCAAGGTGG - Intergenic
1083175278 11:60946055-60946077 GAGGCTGGAGTGAGCCATGATGG - Intronic
1083216240 11:61222147-61222169 GAGGGGGGAGGGTGCCATGGGGG - Intergenic
1083219122 11:61240973-61240995 GAGGGGGGAGGGTGCCATGGGGG - Intergenic
1083334191 11:61913323-61913345 GGGACAGGTGGGAACCAAGGTGG + Intronic
1083470053 11:62878349-62878371 GAGGCTGCAGTGAGCCATGGTGG - Intronic
1083650758 11:64203245-64203267 GAGGCAGGGGGGGCCCCTGGAGG - Intronic
1083707611 11:64526893-64526915 GCAGCAGGTGTGACCCATGGTGG - Intergenic
1083984818 11:66206776-66206798 GAGGGAGGTGAGGGCCATGCAGG + Intronic
1084002268 11:66302811-66302833 GAGGCCTGTCGGAGTCATGGGGG - Intergenic
1084117828 11:67052272-67052294 CTGGCAGTGGGGAGCCATGGTGG + Intergenic
1084179877 11:67440918-67440940 GAGGCAGTGGGAGGCCATGGGGG + Intronic
1084254417 11:67929913-67929935 GAGGCTGCTGTGAGCCATGACGG + Intergenic
1084267583 11:68012793-68012815 GAGGGAGGTGGGAGCTGAGGTGG + Intronic
1084490657 11:69476548-69476570 GGGGGAGGTGGTGGCCATGGGGG - Intergenic
1084652212 11:70495884-70495906 CAGGCAGGTGGCAGCCAGGAAGG - Intronic
1084751657 11:71208188-71208210 GTGGCAGGAGGGTGCCCTGGAGG + Intronic
1084818453 11:71665970-71665992 GAGGCTGCTGTGAGCCATGACGG - Intergenic
1085013909 11:73159937-73159959 AAGGCAGCTGGGAGCCAGGAGGG - Intergenic
1085389269 11:76174289-76174311 GAGGAAAGTGGTAGCCATGGTGG + Intergenic
1085414985 11:76313814-76313836 GAGGAAAGTGAGACCCATGGAGG - Intergenic
1085764439 11:79270746-79270768 GAGGCTGGGAGGAGTCATGGTGG - Intronic
1085810156 11:79672643-79672665 TGGGCAGTGGGGAGCCATGGAGG + Intergenic
1086450140 11:86907528-86907550 GAGGCTGCAGGGAGCCATGATGG - Intronic
1086663887 11:89456558-89456580 GAGGAAGCTGGGAGCCCTGTAGG + Intronic
1086791072 11:91038703-91038725 GAGGCAGGAGGGAGAAATGGAGG + Intergenic
1087527157 11:99330175-99330197 GAGGGAGGAGGGAGGCAAGGAGG + Intronic
1088054948 11:105563499-105563521 GAGGAACGTGGTAACCATGGGGG + Intergenic
1089128165 11:116191880-116191902 GGAGGGGGTGGGAGCCATGGAGG + Intergenic
1089155967 11:116402888-116402910 GTGGCAGGAGGGAGCTATGCAGG - Intergenic
1089156526 11:116406973-116406995 GAGGCAGGCAGGTGCTATGGGGG + Intergenic
1089199531 11:116715501-116715523 CAGCCTGGCGGGAGCCATGGGGG - Intergenic
1089508391 11:118979990-118980012 GAAGCAGGTGGGAACCGTTGGGG - Intronic
1089561064 11:119343450-119343472 GAGGCAGCAGTGAGCCATGATGG + Intronic
1089617334 11:119702253-119702275 GAGGGAGGTGGAGGCCCTGGTGG - Intronic
1089765368 11:120759322-120759344 GAGGCAGGCAGGGGCCAGGGAGG + Intronic
1089854506 11:121531159-121531181 GAGGCAGGTGGAAGCACTTGAGG + Intronic
1090423678 11:126592676-126592698 AAGGGAGGAGGGAGCCAGGGTGG + Intronic
1090625640 11:128606130-128606152 GTGGGAGAGGGGAGCCATGGAGG - Intergenic
1090952726 11:131487771-131487793 GGGGAAGGCTGGAGCCATGGAGG + Intronic
1202807669 11_KI270721v1_random:13864-13886 GAGGCCTGTGGGAGACATGGGGG - Intergenic
1091556081 12:1574443-1574465 GAGGCTGGTGGCAGCCGTGTGGG + Intronic
1092291156 12:7160186-7160208 GAGGCAGGTGGGAGGCAGGTGGG - Intergenic
1092291173 12:7160233-7160255 GAGGCAGGTGGGAGGAGAGGTGG - Intergenic
1092291184 12:7160267-7160289 GAGGCAGGTGGGAGGCAGGCGGG - Intergenic
1092291193 12:7160290-7160312 GAGGCAGGTGGGAGGAGAGGTGG - Intergenic
1092291201 12:7160313-7160335 GAGGCAGGTGGGAGGACAGGTGG - Intergenic
1092291204 12:7160324-7160346 GAGGCAGGTGGGAGGCAGGTGGG - Intergenic
1092291208 12:7160335-7160357 GAGGCAGGTGGGAGGCAGGTGGG - Intergenic
1092920899 12:13230848-13230870 GAGGCAGGAGAGAGACATGCTGG + Intergenic
1094609480 12:31979600-31979622 GAGGCTGCAGTGAGCCATGGTGG - Intronic
1095399729 12:41800667-41800689 GGGGGAGATGGGAGGCATGGAGG - Intergenic
1096238184 12:49943734-49943756 GAGGCAGCTGGGAGCCATTGTGG - Intergenic
1096252339 12:50041160-50041182 GAGGCAGGAGGGAAGCACGGAGG - Intergenic
1096749038 12:53747263-53747285 GAGGCAGGAGGCAGGCATGATGG + Intergenic
1096805149 12:54136046-54136068 GAGGCAGGTGGGGGACAAGAGGG + Intergenic
1097169099 12:57102558-57102580 CAGGCAGGTGGGAGGGATGAAGG - Intronic
1098445523 12:70562217-70562239 GAGGCTGCAGGGAGCCATGATGG + Intronic
1098950912 12:76639749-76639771 GAGGTAGGTGGGGGCCTGGGAGG - Intergenic
1100554970 12:95684361-95684383 GAGGCTGCAGTGAGCCATGGTGG - Intronic
1100885803 12:99068679-99068701 GATGCAGGTGGGAGGGGTGGGGG + Intronic
1101797230 12:107986307-107986329 CAGGGAGTTGGAAGCCATGGTGG + Intergenic
1102015110 12:109643117-109643139 GAGGGAGCTGGGAGCCATGGTGG - Intergenic
1102205780 12:111089931-111089953 GAGGGTGATGGGAGCCATGGAGG + Intronic
1102253594 12:111404096-111404118 AAGGCAGTAGGGTGCCATGGAGG - Intergenic
1102261288 12:111444986-111445008 CAGGCAGGTGGCAGCCAGGCTGG + Intronic
1102464208 12:113119082-113119104 GAGGCACTGGGGAGCCATGGAGG + Intronic
1102521546 12:113480194-113480216 AAGGCAGGGGTGAGCCACGGTGG + Intergenic
1102551272 12:113693860-113693882 GAGGGAATGGGGAGCCATGGAGG + Intergenic
1102630354 12:114273038-114273060 CAAGCAGGTATGAGCCATGGGGG + Intergenic
1102865166 12:116368507-116368529 GAGGCAGGAGGAAGCCCTGAGGG - Intergenic
1103463719 12:121125088-121125110 AAGGCAGGTGGGTGGGATGGTGG - Intergenic
1103712473 12:122923165-122923187 GAGGCAGCAGTGAGCCATGATGG - Intronic
1103883836 12:124186431-124186453 GCAGCCGTTGGGAGCCATGGAGG + Intronic
1103911778 12:124355940-124355962 GAGGACAGTGGGAGCCATCGAGG - Intronic
1104056580 12:125235339-125235361 GACAAAGGTGGGATCCATGGAGG - Intronic
1104386472 12:128355567-128355589 GAATAAGATGGGAGCCATGGAGG - Intronic
1104656613 12:130578363-130578385 CTGGCAGCTGGGAGCCATGTTGG - Intronic
1104837028 12:131798237-131798259 GAGGCTGCTGTGAGCCATGACGG + Intronic
1104874772 12:132026309-132026331 GAGGCAGGTGGGAGCCTAGAGGG + Intronic
1104912725 12:132247482-132247504 GAGGCAGCTGGAAGCCAAGCTGG - Intronic
1104933511 12:132352714-132352736 GAGGCTGCTGGGAGCCGTGATGG + Intergenic
1104971749 12:132533955-132533977 GAGGCGGGTGGGTGCCACTGTGG + Intronic
1105345698 13:19570383-19570405 GAGGCAGGTGGGATCCCTTGAGG + Intergenic
1106578729 13:30999779-30999801 GAGGCAGGTGGAAGGCAGTGGGG + Intergenic
1107338873 13:39384941-39384963 GAGGAAGGTGGGAACCAAGGTGG + Intronic
1107984777 13:45766116-45766138 GAGGCACTAGGGATCCATGGTGG + Intergenic
1108471728 13:50773893-50773915 GAGGCAGGCAGGAGCTGTGGTGG + Intronic
1108798740 13:54067078-54067100 GGGGCAGGTGGGGGTCAGGGTGG - Intergenic
1110309969 13:74037408-74037430 GATGCATGTGGTAGGCATGGGGG - Intronic
1111899964 13:94188603-94188625 GAAGGAGACGGGAGCCATGGTGG + Intronic
1112295411 13:98182388-98182410 GAGGCAGCAGTGAGCCATGATGG - Intronic
1113314445 13:109163503-109163525 GAGGGAGGTGGGAGGGAGGGAGG - Intronic
1113642417 13:111967257-111967279 CAGCAAGGTGGGAGCCATGCTGG + Intergenic
1113672800 13:112186281-112186303 CAGGCATGTGGCAGCCCTGGGGG + Intergenic
1113794726 13:113050638-113050660 GGGGGCGGTGGGAGCCGTGGGGG + Intronic
1113849015 13:113407473-113407495 GACGCAGGTGCTGGCCATGGTGG + Intergenic
1114503053 14:23186008-23186030 GAGGATCGTGTGAGCCATGGAGG + Intronic
1117551026 14:56836489-56836511 GAGGCCGGTGGGGGCAGTGGTGG - Intergenic
1118337182 14:64863457-64863479 GAGCCAGGTAGGTGCCATTGTGG - Intronic
1119827318 14:77668278-77668300 GAGGCAGAAGGGAGCCCTTGGGG - Intergenic
1119908249 14:78325043-78325065 GAGGCAGGTAGGAACAATGCGGG + Intronic
1120219620 14:81717472-81717494 GTGGCAGGTGGGAGTCAGGAAGG + Intergenic
1120471012 14:84924630-84924652 AAGTCAGGTGGGAGTCATGAAGG - Intergenic
1121096761 14:91222697-91222719 GAGCCAGCTGAGAGCCCTGGAGG - Intronic
1121533916 14:94678009-94678031 GAGGCTGGTGTGGGCGATGGTGG - Intergenic
1121950524 14:98167390-98167412 GAGGCAGGTGGGAGCCTCCATGG - Intergenic
1122091358 14:99343032-99343054 GATGCAGGGGGCAGCCAGGGTGG + Intergenic
1122144248 14:99679759-99679781 GAGGCTGGTGGCATCCATGCTGG + Exonic
1122196383 14:100089866-100089888 GAGGCTGCAGTGAGCCATGGTGG + Intronic
1122631423 14:103109312-103109334 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631437 14:103109348-103109370 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631451 14:103109384-103109406 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631465 14:103109420-103109442 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631479 14:103109456-103109478 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631493 14:103109492-103109514 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631521 14:103109565-103109587 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631535 14:103109601-103109623 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631549 14:103109637-103109659 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122743918 14:103887158-103887180 GAGGCAGGGGGCAGCCAGGCTGG - Intergenic
1123003121 14:105307235-105307257 GAGGCAGGTGGGACTCATGATGG - Exonic
1123842320 15:24260880-24260902 GGTGTAGGTGGGATCCATGGAGG + Intergenic
1124155954 15:27225576-27225598 AAGGCAGGTGGGAAGCATAGAGG - Intronic
1124345021 15:28916488-28916510 GAGACAGGTGGGAGCAGAGGGGG - Intronic
1124410231 15:29430710-29430732 GAGGAAGGAGGGAGGAATGGAGG + Intronic
1124661366 15:31553375-31553397 GAGCCAGGTTGGGGGCATGGTGG + Intronic
1124832842 15:33165822-33165844 GAGGAAGGTGGGGACCATGGGGG + Intronic
1125008594 15:34845968-34845990 GAGGCTGCTGTGAGCCATGGTGG - Intergenic
1125729226 15:41883407-41883429 GAAGCAGGTGGCAGACATGCAGG - Exonic
1126980738 15:54239737-54239759 TAAGGAGGTGGGGGCCATGGTGG - Intronic
1127811983 15:62572897-62572919 AAGGCTGGGAGGAGCCATGGGGG - Intronic
1128246826 15:66138712-66138734 GAGGAAGCTGGGAGCCCGGGAGG - Intronic
1128512064 15:68319436-68319458 GTCCCAGGTGGGGGCCATGGTGG + Intronic
1128669503 15:69563939-69563961 GAGGCTGCTGTGAGCCATGATGG - Intergenic
1128739585 15:70074342-70074364 GAGGCAACTGGGAGCCAAGGGGG + Intronic
1128768940 15:70267533-70267555 CAGGCAGTGGGGAGCCATGGAGG - Intergenic
1129232824 15:74206193-74206215 GGGGCAGGTGGGAGGCAATGGGG - Intronic
1129272516 15:74426898-74426920 TGGGCAGTTAGGAGCCATGGTGG - Intronic
1129333952 15:74841568-74841590 GAGGCAGATGTGAGCCGGGGAGG - Intronic
1129466833 15:75728772-75728794 TGGGAGGGTGGGAGCCATGGAGG + Intergenic
1129720402 15:77874982-77875004 AGGGAGGGTGGGAGCCATGGAGG - Intergenic
1130008773 15:80130052-80130074 GGGGTAGTTGGGAGCCATTGAGG + Intronic
1130375340 15:83323981-83324003 GGGGCAGGTGGAGGCCTTGGAGG - Intergenic
1130650609 15:85760212-85760234 TTGGCAGGTGTGTGCCATGGGGG + Exonic
1130910392 15:88266513-88266535 GAGAGAGGTGGGAGCCAGAGGGG + Intergenic
1131046867 15:89322077-89322099 TGGGCAGGTGAGGGCCATGGTGG - Intronic
1131578271 15:93614042-93614064 GAGGGAGGTGGGAGAGAGGGCGG + Intergenic
1131867280 15:96724462-96724484 GAGGTTGGGGGAAGCCATGGCGG + Intergenic
1131923338 15:97354259-97354281 CAGGCAGGAGAGAGACATGGAGG - Intergenic
1132588869 16:717770-717792 GAGGCAAGTGGGAGCCAGCCAGG - Exonic
1132742901 16:1424489-1424511 GAGGATGGTGGGAGCCCAGGAGG - Intergenic
1132771400 16:1565441-1565463 GAGGCAGGGGGAATCCAGGGGGG + Intronic
1132905105 16:2278462-2278484 GAGGCAGGAGGGTGCCAGGTGGG + Intronic
1132939288 16:2499012-2499034 CAGGCATGTGGGAGCCAAAGAGG - Intronic
1133254878 16:4510452-4510474 GTGGCTGCTGGGAGCCATGATGG - Intergenic
1133412494 16:5580141-5580163 GAGGCAGCTGGGAACGAGGGAGG - Intergenic
1134135648 16:11674787-11674809 TGGGCAGGTGGGAGGCAGGGAGG - Intronic
1134449222 16:14353740-14353762 GAGGCAGGAGGGAGGGAGGGAGG + Intergenic
1134514155 16:14873365-14873387 GAGGCAGGGGGAGGCAATGGGGG + Intronic
1134701797 16:16271864-16271886 GAGGCAGGGGGAGGCAATGGGGG + Intronic
1134970033 16:18522786-18522808 GAGGCAGGGGGAGGCAATGGGGG - Intronic
1135046016 16:19156433-19156455 GATGAAGGAGTGAGCCATGGGGG + Intronic
1135107393 16:19662136-19662158 GAGGCAGGAGTGAGCTATGACGG + Intronic
1135222471 16:20624846-20624868 GGGGCAGGTGGGTGGAATGGGGG - Intronic
1135425676 16:22333487-22333509 GTGGCTGGTAGTAGCCATGGTGG + Intronic
1136136539 16:28259761-28259783 ACGGGAGCTGGGAGCCATGGAGG - Intergenic
1136298912 16:29320381-29320403 GAGGAGGGTGGGAGCCCAGGAGG + Intergenic
1136445431 16:30314837-30314859 GAGGCGGGTGGGATCCCTTGAGG - Intergenic
1138375538 16:56561270-56561292 GAATCAGGTGGCAGCCATGGAGG + Intergenic
1138389206 16:56657986-56658008 GGGGCAGGTGGAAGGCGTGGTGG - Exonic
1138389926 16:56662884-56662906 GGGGCAGGTGGGAGGCATGGTGG + Intronic
1138391873 16:56676117-56676139 GGGGCAGGTGGGAGGCGTGGTGG - Exonic
1139086656 16:63595189-63595211 GAGACAGGGGAGCGCCATGGTGG - Intergenic
1139521579 16:67485757-67485779 GAGGCTGCAGTGAGCCATGGTGG + Intergenic
1139671105 16:68492945-68492967 GAGGCAGGTGGCAGCCATCCCGG - Intergenic
1140133709 16:72186527-72186549 GAGGCAACAGGGAGCCATGAAGG + Intergenic
1140937824 16:79691251-79691273 TAGGCAGGAGGGAGCCTTGATGG - Intergenic
1141161685 16:81633358-81633380 CCAGCAGGTGGGAGCCCTGGAGG - Intronic
1141678230 16:85528980-85529002 GAATCAAATGGGAGCCATGGAGG + Intergenic
1141767460 16:86067963-86067985 GGGAGGGGTGGGAGCCATGGGGG + Intergenic
1142060593 16:88026936-88026958 GAGGAGGGTGGGAGCCCAGGAGG + Intronic
1142375806 16:89706623-89706645 GAGGCAGGTGGCAGGGCTGGTGG - Intergenic
1142494243 17:297955-297977 GAGAGAGGTGGGGGCCAGGGAGG - Intronic
1142613835 17:1123962-1123984 GGGGCAGGTGGGAGGCAAGGGGG - Intronic
1142961174 17:3553382-3553404 AGGGCAGTGGGGAGCCATGGAGG - Intronic
1143027850 17:3951565-3951587 GTGGCAGGTGGGAGGCACTGGGG - Exonic
1143033755 17:3982662-3982684 GAGGCTGGGTGGAGGCATGGAGG - Intergenic
1143137564 17:4720293-4720315 GAGGCGGGTGAGTGTCATGGGGG + Exonic
1143202391 17:5121954-5121976 TAGGCAATGGGGAGCCATGGAGG + Intronic
1143229582 17:5341214-5341236 GAGGCTGTGGTGAGCCATGGTGG + Intronic
1143673728 17:8415111-8415133 GAGGCAGGAGGGAGGGAGGGAGG - Intronic
1144623807 17:16834196-16834218 GAGGGAGCTGGGATCCAGGGAGG + Intergenic
1144626981 17:16848976-16848998 TAGGCAATGGGGAGCCATGGAGG - Intergenic
1144710691 17:17399644-17399666 GAGGGAGGTGGGAGCCCTGGAGG - Intergenic
1144727901 17:17511039-17511061 CAGAGAGGTGGGAGCCATAGGGG - Intronic
1144743527 17:17597767-17597789 GAGGCAGCAGTGAGCCATGATGG + Intergenic
1144762040 17:17712537-17712559 ATGTGAGGTGGGAGCCATGGAGG + Intronic
1144830864 17:18130540-18130562 TTGGCTGGTGGTAGCCATGGGGG + Intronic
1144848907 17:18234225-18234247 CAGGCAGGCATGAGCCATGGTGG - Intronic
1144879459 17:18423736-18423758 TAGGCAATGGGGAGCCATGGAGG + Intergenic
1144960105 17:19039976-19039998 AGGGCAGTTGGGAGCCATGGAGG - Intronic
1144975055 17:19134548-19134570 AGGGCAGTTGGGAGCCATGGAGG + Intronic
1145152782 17:20520651-20520673 TAGGCAATGGGGAGCCATGGAGG - Intergenic
1145962841 17:28897490-28897512 GAGGAAGGTGGGAGCTGTGGAGG - Intronic
1146054264 17:29573421-29573443 GAGGGAGGTGGCAGACATGAAGG - Intergenic
1146063587 17:29619339-29619361 GAAGCAGCTGGGAGCCAGGAGGG + Intronic
1146164119 17:30574822-30574844 TAGGCAATGGGGAGCCATGGAGG - Intergenic
1146184871 17:30718211-30718233 CAGGCAATAGGGAGCCATGGAGG + Intergenic
1146185063 17:30719417-30719439 GAGTGAGGTGGGAGCCACGGAGG + Intergenic
1146642602 17:34552656-34552678 GAGGCAGATGGTAGCCATGGAGG + Intergenic
1146663144 17:34678556-34678578 TAGGCAATAGGGAGCCATGGAGG - Intergenic
1147025989 17:37583925-37583947 GAGGCAGGTGGGATCACTTGAGG - Intronic
1147056074 17:37836260-37836282 GAGTGATGTGGGAGCCATGGGGG - Intergenic
1147384671 17:40074264-40074286 GTGGCAGGTGGGAGGGCTGGGGG - Exonic
1147400292 17:40176952-40176974 CAGGCAGGTAGGAGCCAGGCAGG - Intergenic
1147581115 17:41627661-41627683 TAGGCAATGGGGAGCCATGGAGG - Intergenic
1147769943 17:42860541-42860563 GAGGCTGCAGTGAGCCATGGTGG - Intergenic
1148010967 17:44480969-44480991 GAGGCTGGAGTGAGCCATGATGG - Intronic
1148053764 17:44781640-44781662 CAGACAGCTGGGAGCCAGGGTGG - Exonic
1148240352 17:45996270-45996292 TAGGCAGGTGGAAGCCAGGTTGG - Intronic
1148552690 17:48559986-48560008 CAGGCAGGTGGGCTCCTTGGTGG + Intronic
1148756954 17:49978216-49978238 GAGGCAGGAGGGGGACATGATGG + Intergenic
1148841226 17:50498583-50498605 GACCCAGGTGGGAGCCATTCAGG - Intergenic
1149421104 17:56511294-56511316 AACGCAGGTAGCAGCCATGGAGG - Intronic
1149535645 17:57431458-57431480 GAGGCAGGTGGTAGGTTTGGGGG + Intronic
1149865487 17:60149049-60149071 GAGGCAGCTTGGGGGCATGGGGG + Intergenic
1149993330 17:61394713-61394735 GAGGCCGGTGGGAGCCAGCGTGG + Intergenic
1150254112 17:63730483-63730505 GAGGATGGTTGGAGCCCTGGAGG - Intronic
1150267751 17:63842233-63842255 GAAGCAGCTGGGAGGCCTGGGGG - Intronic
1150588813 17:66542688-66542710 AAGACAAGTGGGAGCCATTGGGG + Intronic
1150690132 17:67358476-67358498 GAGGCTGGCTTGAGCCATGGAGG + Intronic
1151190688 17:72395700-72395722 GAAGCAGGATGGAGTCATGGTGG - Intergenic
1151429627 17:74053564-74053586 GTGGCAGGTGGGAGCGAGAGAGG - Intergenic
1151552196 17:74828556-74828578 GAGGCTCTTGGGAGCCATAGAGG - Intronic
1151560307 17:74866308-74866330 GAGGCCGCTGGGAGCCTGGGGGG - Intronic
1151952243 17:77361470-77361492 CAGGCAGGTGGGATCGAGGGTGG + Intronic
1152193631 17:78903333-78903355 CAAGCAGCCGGGAGCCATGGGGG + Intronic
1152280705 17:79383562-79383584 GGGGCAGGAGGCAGCCATCGGGG - Intronic
1152633514 17:81421149-81421171 GAGGCAGCTGGGGGCCAGGGAGG - Intronic
1152755056 17:82083741-82083763 GAGGCAGGTGGGGGCTGTGGGGG + Intronic
1152781152 17:82228003-82228025 GAGGCAGGGGGTATCAATGGAGG - Intergenic
1153151870 18:2105148-2105170 GTGGCATGTGGGAGCCATGAGGG - Intergenic
1153449977 18:5216434-5216456 GAGGCTGCAGTGAGCCATGGTGG - Intergenic
1153647254 18:7206324-7206346 GAGGCAGGTGGGAGATGCGGTGG - Intergenic
1153993714 18:10422012-10422034 GAGGCATCTGAGAGCCAAGGAGG + Intergenic
1155073171 18:22333949-22333971 GAGGCTGCAGTGAGCCATGGTGG - Intergenic
1155101532 18:22615088-22615110 GAGGCAGCTGTGAGGCATGGGGG + Intergenic
1155520852 18:26667628-26667650 GAGGAAGGAGGGAGACAGGGAGG + Intergenic
1155853432 18:30801442-30801464 GAGGCAGGTGGGATCACTTGAGG + Intergenic
1156260121 18:35438670-35438692 GAGGCAGTAGGGAGCCATTCAGG - Intergenic
1157449521 18:47774708-47774730 GAGGAGGGTGGGAGCCTGGGAGG - Intergenic
1158900533 18:61957893-61957915 GCTGCACGTGGGAGCCCTGGAGG + Intergenic
1159154897 18:64571156-64571178 TAGGTATGTGTGAGCCATGGTGG + Intergenic
1160022683 18:75192675-75192697 AGGGCAGGTAGGAGCCAGGGTGG - Intergenic
1160031965 18:75269816-75269838 GTGGCTGCTGGGAGCCAGGGGGG - Intronic
1160415017 18:78703692-78703714 GAGGCAGGACAGAGGCATGGCGG + Intergenic
1160425111 18:78773919-78773941 CAGGCAGGTGAGGGCCGTGGGGG - Intergenic
1160671827 19:368795-368817 GAGGCTGGAGGGAGCCAGGGAGG - Intronic
1160696005 19:484835-484857 GAGCAGGGTGGGAGCCACGGAGG + Intergenic
1160744592 19:704652-704674 GAGGGAGGTGTGAGTCCTGGAGG + Intergenic
1160751796 19:737869-737891 GAGGGAGGCAGGAACCATGGGGG + Intronic
1160758577 19:771465-771487 GAGGGAAATGGGAGCCATGGAGG - Intergenic
1160758790 19:772125-772147 GAGGAAGGGGGGAGACAGGGAGG - Intergenic
1160809692 19:1008023-1008045 GGGGCAGTGGGGAGCCACGGAGG + Intronic
1160826096 19:1081259-1081281 GAGGCAGGGGGCAGACCTGGAGG + Intronic
1160904322 19:1445394-1445416 GCGGGAGGTGGGAGCCACCGCGG - Intergenic
1160906253 19:1453037-1453059 GAGGCAGGTGGAGGCCTTGAAGG + Exonic
1160940483 19:1618422-1618444 GAGAAAGGTGGCAGCCGTGGAGG - Intronic
1160960820 19:1720025-1720047 GAGGTAGCAGGGAGCCATGGAGG + Intergenic
1160988452 19:1850975-1850997 GAGGGCAGTGGGAGCCATGGAGG + Intergenic
1161031097 19:2058100-2058122 GAGGGAGGTGGGACCAGTGGCGG - Intergenic
1161038501 19:2098011-2098033 GAGGCTGAGGGGAGCCCTGGCGG + Intronic
1161098919 19:2410669-2410691 AAGGGAGCAGGGAGCCATGGAGG - Intronic
1161137127 19:2626424-2626446 AGGGCAGGAGGGAGCCATAGCGG - Intronic
1161195172 19:2982644-2982666 AAGGGAGGTGGGAGCCATGGAGG + Intronic
1161195424 19:2983693-2983715 GAGGGAGGTGGGAGCCATGGAGG + Intronic
1161208960 19:3056497-3056519 GAGGCAGGTGGGAGGGAAAGAGG + Intronic
1161213355 19:3079863-3079885 AAGGAAGGTGGGAGCCATGGAGG + Intergenic
1161222876 19:3126091-3126113 GAGGGAGGTGGGAGCCCTGGAGG + Intergenic
1161226130 19:3146822-3146844 GAGGGACTTGGGAGCCATGGAGG - Intronic
1161238846 19:3210804-3210826 AGGGCAGCTGGGAGCCATGGAGG + Intergenic
1161243312 19:3234979-3235001 AAGGGAGGTGGGAGCCACGGAGG - Intronic
1161257329 19:3316595-3316617 GAGGAAGGTGGGAGCCATGGAGG + Intergenic
1161258870 19:3324635-3324657 GAGGGAGGTAGGAGCCATGGAGG - Intergenic
1161273122 19:3401224-3401246 AAGGCAGGTGGGAGCCATAGAGG + Intronic
1161274940 19:3410622-3410644 AAAGAAGGTGGGAGCTATGGAGG + Intronic
1161279539 19:3438261-3438283 GAAGGAGGTGGTAGCAATGGGGG + Intronic
1161286481 19:3471107-3471129 GAAGGAGGTGGGAGCCATGGAGG + Intergenic
1161289430 19:3485109-3485131 GAGGAATGTGGGAGCCATGGAGG + Intergenic
1161331958 19:3692740-3692762 AAGGGAGGTGGGAGCCATGGAGG - Intronic
1161332918 19:3696819-3696841 AAGGGAGGTGGGAGCCATGGAGG + Intronic
1161431254 19:4233592-4233614 AAGGCAGGTGGGAGCCATGGAGG - Intronic
1161477711 19:4495654-4495676 GAGGGAGGTGGGAGCCATGGAGG + Intronic
1161480117 19:4506174-4506196 AAGGGAGTTGGGAGCCCTGGAGG - Intronic
1161482976 19:4519889-4519911 GGAGAAGGTGGGAGCCATGGAGG - Intergenic
1161484046 19:4525231-4525253 AAGGGAGGTGGGAGCCATAGAGG + Intronic
1161488278 19:4547692-4547714 GAAGGAGATGGGAGCCATGTAGG - Intronic
1161490359 19:4557862-4557884 GAGGAAGGTGGGAGCCACGGAGG - Intronic
1161492110 19:4567786-4567808 GAGGCAGGTGGGAGCCATGGAGG - Intergenic
1161493700 19:4576226-4576248 CAGGGAGGTGGGAGCCATGGAGG - Intergenic
1161503847 19:4633316-4633338 GAGGGAGGTGGGAGCCATAGAGG + Intergenic
1161505806 19:4642821-4642843 AAGGGAGGTGGGAGCCATGGAGG + Intronic
1161522208 19:4730943-4730965 GAGAGAGGTGGGAGCCATGGAGG - Intergenic
1161534707 19:4811912-4811934 CAGGCGGGTGGGAGCCATGCAGG - Intergenic
1161558592 19:4958124-4958146 GAGGCAGGTGGGGCCCGAGGAGG - Intronic
1161596679 19:5154259-5154281 GAGGGAGGTGGGAGCCATGGAGG + Intergenic
1161599192 19:5170523-5170545 GAGGAAGGTGGGAGCCATGGAGG + Intronic
1161605631 19:5213293-5213315 GTGGGAGGCAGGAGCCATGGAGG - Intronic
1161608182 19:5226193-5226215 AAGAGAGGTGGGAGCCATGGAGG - Intronic
1161619180 19:5289482-5289504 GAGGCAGGTGGGAGCCATGGAGG - Intronic
1161620950 19:5296802-5296824 GAGGAAGGTGGGAGCCATGGAGG + Intronic
1161621396 19:5299174-5299196 GAGGGAGGTGGGAGCCATGGAGG - Intronic
1161623173 19:5309955-5309977 GAGGGAGGTGGGAGCCAGGGAGG - Intronic
1161624684 19:5319556-5319578 TAGAGAGGTGGGAGCTATGGAGG - Intronic
1161630831 19:5354604-5354626 GAGGGAGGCGGGAGCCATGGAGG + Intergenic
1161633256 19:5370117-5370139 GAGGGAGGTGACAGCCATGGAGG - Intergenic
1161634301 19:5377591-5377613 GAGGAAGGTGGGAACCATGGGGG + Intergenic
1161642918 19:5435598-5435620 AAGGGAGATGGAAGCCATGGAGG - Intergenic
1161644478 19:5444629-5444651 GAGGAAGATGGGAGCCATGGAGG - Intergenic
1161649373 19:5474870-5474892 GAGGGAGGCGGGAGCCATGGAGG + Intergenic
1161650398 19:5480659-5480681 GAGGGAGGTGGGAGCCATTGAGG + Intergenic
1161657154 19:5523345-5523367 CAGGGAAGTGGGAGCTATGGAGG - Intergenic
1161663843 19:5563195-5563217 GAGGGAGGTGGGAGCCATGGAGG + Intergenic
1161664186 19:5565048-5565070 GAGGGAGGTGGGAGCCATAGAGG - Intergenic
1161664612 19:5567918-5567940 GAGCCGGGCGGGCGCCATGGAGG - Intergenic
1161718394 19:5890192-5890214 AAGTGGGGTGGGAGCCATGGAGG + Intronic
1161756450 19:6137544-6137566 GAGGGAGGTGGGAGCCATGGAGG + Intronic
1161760555 19:6168065-6168087 GAGGGAAGTGGGAGCCATGGAGG - Intronic
1161815664 19:6498461-6498483 AAGGTAGGTGGGAGCCATGGAGG - Intronic
1161846954 19:6717159-6717181 TAGGAAGGTGGGAGCCATGGAGG + Intronic
1162063733 19:8111916-8111938 GAGGTAGGTGGGGGGCAAGGCGG - Intronic
1162072003 19:8158566-8158588 GCGGCAGCAGGGAGCCACGGTGG + Intronic
1162087875 19:8259464-8259486 GGGGGAGATGGGAGCCATGGAGG + Intronic
1162087969 19:8259955-8259977 AAGACAGGTGGGAGCCATGGAGG - Intronic
1162110390 19:8396777-8396799 GCGGAAGGTGGGGGCCACGGAGG + Intronic
1162131298 19:8527582-8527604 GAGGAAGGTGGGAGCCCTCCAGG + Intronic
1162144558 19:8605693-8605715 CTGGCAGGCGGGAGCCATAGAGG + Exonic
1162148637 19:8629478-8629500 TGAGGAGGTGGGAGCCATGGAGG + Intergenic
1162155153 19:8672975-8672997 GAGGCTGGTGGGGGCCCAGGTGG + Intergenic
1162258219 19:9510433-9510455 GAGACTGGAGGGATCCATGGCGG - Intergenic
1162304463 19:9863326-9863348 GAGGAAGGTGGGAGCCATGGAGG + Intronic
1162308071 19:9887719-9887741 AGGGGAGATGGGAGCCATGGAGG - Intronic
1162342826 19:10102259-10102281 GAGTCAGGCAGGAGCCATGGAGG + Intronic
1162429942 19:10622328-10622350 GAATGAGGTGGGAACCATGGAGG + Intronic
1162491048 19:10991882-10991904 GAGTAAAGTGGGAGCCATAGAGG + Intronic
1162534088 19:11253057-11253079 GAGGGCGGTGGGAGCCATGGAGG + Intronic
1162542540 19:11306429-11306451 GAGTGAGATGGGAGCCAGGGAGG + Intronic
1162569086 19:11460432-11460454 GAGGAAGGTGGGAGCCATAGAGG - Intronic
1162766774 19:12924607-12924629 GGGGCAGGGGTGGGCCATGGTGG - Intronic
1162806380 19:13139913-13139935 GAGGCAGATGAGAGGCAGGGAGG - Exonic
1162819340 19:13213079-13213101 CAAGCAAGTGGGAGCCATGGAGG - Intronic
1162829953 19:13278208-13278230 GAATGAGGTGGGAGCCACGGAGG - Intronic
1162833188 19:13299533-13299555 TAGCCAGGTGGGAGCCATGGAGG - Intronic
1162836008 19:13318453-13318475 GAGTGAGGGGGGAGCCGTGGAGG + Intronic
1162844492 19:13381907-13381929 GAGTAAGGTGTGAGCCATGGAGG + Intronic
1162857077 19:13476968-13476990 GAGGGAGCTGGGAGCCACGGAGG - Intronic
1162871682 19:13591199-13591221 GAGTCAGGTGGGAGCCATGGAGG + Intronic
1162894663 19:13758000-13758022 GAGGAAGGTGGGAGCCATGGAGG - Intronic
1162897921 19:13776479-13776501 GGGTGAGGTGGAAGCCATGGAGG - Intronic
1162913149 19:13860819-13860841 GAATAAGGTGGGAGCCATTGAGG + Intergenic
1162918754 19:13888338-13888360 GAGGCAGGTGGGAGGGGAGGAGG - Intronic
1162973715 19:14196272-14196294 GAGTGAGGTGGGAGCCACGGAGG - Intronic
1162973910 19:14197484-14197506 CAGGCAATAGGGAGCCATGGAGG - Intronic
1162999251 19:14355873-14355895 GGGTGAGGTGGGAGCCATAGAGG + Intergenic
1163000141 19:14362114-14362136 GAGTGAGGTGGGAGCCCTGGAGG + Intergenic
1163011731 19:14430876-14430898 GAGTGAGCTGGGAGCCATGGAGG + Intergenic
1163064882 19:14785479-14785501 GGGTAAGGTGGGAGCCATAGAGG - Intergenic
1163157083 19:15445466-15445488 AAGGCTGGTGGGAGGCCTGGGGG + Intronic
1163166367 19:15500804-15500826 GAGGAAGGTGGGAGCCATACAGG - Intergenic
1163258694 19:16173508-16173530 GAGGAAGCTGGGAGCCTTTGGGG - Exonic
1163311369 19:16516929-16516951 CAAGCAGCTGGGAGCTATGGTGG - Intronic
1163479789 19:17548331-17548353 CAGGCAGTGGGGAGCCATGGAGG + Intronic
1163565112 19:18046503-18046525 GAGGAAGGTGGGAGCCACAGAGG + Intergenic
1163919398 19:20274742-20274764 GGAGCAGGTGGCAGCCTTGGAGG - Intergenic
1164630541 19:29759056-29759078 GACCCAGGAGGGAGGCATGGAGG + Intergenic
1164983087 19:32628600-32628622 GAGGCAGCTGGGGGGCAGGGAGG + Intronic
1165060149 19:33201213-33201235 GAGGCTGGGGGGAGGGATGGAGG + Intronic
1165215696 19:34270605-34270627 GAGGAAGGAGGGTGCCATAGAGG - Intronic
1165320270 19:35080645-35080667 CAGGCAGGAGGGAGCCATCAGGG - Intergenic
1165335093 19:35164109-35164131 AGGGCAGGAGTGAGCCATGGAGG - Intronic
1165468242 19:35987577-35987599 GAGGCTGCAGTGAGCCATGGTGG + Intergenic
1166060124 19:40320803-40320825 CAGGCAGGTGAAATCCATGGGGG + Exonic
1166112735 19:40632837-40632859 GAGGCTGCAGTGAGCCATGGTGG - Intergenic
1166168129 19:41006908-41006930 GAGGAAGGTGGGGTCCATGAGGG - Exonic
1166398081 19:42457170-42457192 GAGGCAGGGGCCAGGCATGGTGG - Intergenic
1166557441 19:43710291-43710313 GAGAGGTGTGGGAGCCATGGGGG - Intergenic
1166658460 19:44629161-44629183 GAGTGAGATGGAAGCCATGGAGG + Intronic
1166673913 19:44727710-44727732 GAGGGAGATGGGAGCCATGGAGG - Intergenic
1166696787 19:44856482-44856504 GTGGCAAGTGGGAGCCGTTGCGG - Intronic
1166731164 19:45059819-45059841 GAGGGAGGTGGGAGCCACAAAGG - Intronic
1166889250 19:45980375-45980397 GATTTAAGTGGGAGCCATGGGGG + Intergenic
1166934016 19:46320403-46320425 AAGGGAGGTGGGAGTCAGGGAGG - Intronic
1166978982 19:46621723-46621745 GTGGGAGGAGGGAGCCAGGGTGG - Intronic
1166979116 19:46622278-46622300 GAGGCAGAGGGGAGCCAGGTAGG + Intronic
1167153677 19:47725119-47725141 GAGGCATGTGGCAGGCTTGGGGG + Intronic
1167245909 19:48373172-48373194 GAGGCACTGGGGAGCCATGAGGG + Intronic
1167463024 19:49636261-49636283 GAGGAACTGGGGAGCCATGGAGG + Intronic
1167510483 19:49893172-49893194 GAGGCAGCGGGGAGCCACTGGGG + Intronic
1167602003 19:50459813-50459835 GAGGAAGTGGGGAGACATGGGGG + Intronic
1168405551 19:56108440-56108462 GAGGCAGCTGGGAGGACTGGAGG - Intronic
1168409204 19:56128157-56128179 GAGGCTGCAGTGAGCCATGGTGG + Intergenic
1168588643 19:57614758-57614780 GAGGACGATAGGAGCCATGGCGG + Intronic
926192527 2:10739488-10739510 AAGGCAGGATGGAGCCAGGGTGG - Intronic
926811138 2:16756413-16756435 GAGGCAGGGAGGAGCCGGGGAGG - Intergenic
927861148 2:26561053-26561075 CAGGCAGGTGGAAGGCAGGGTGG + Intergenic
927880030 2:26683821-26683843 GAGGCAGTTGGGGGACATGAAGG - Intergenic
928167445 2:28981399-28981421 GTGGCTGGTGGGGGCCAGGGTGG + Exonic
928260084 2:29758621-29758643 GAGGGAGGAGGGAGCCGAGGAGG - Intronic
928500015 2:31881428-31881450 GAGGCAGCAGTGAGCCATGATGG + Intronic
929779783 2:44949982-44950004 CAGGCGAGAGGGAGCCATGGAGG + Intergenic
929932009 2:46264661-46264683 GAGGCCTGTGGGAGCCGTGGAGG + Intergenic
930495331 2:52134567-52134589 GAGGGAGGTGGGGCCCATGCAGG - Intergenic
931746175 2:65293678-65293700 GAGGCAGGTGGGAGGATAGGCGG + Intergenic
931838885 2:66128332-66128354 CAGGCAGGTGGGCAGCATGGTGG - Intergenic
931869241 2:66441149-66441171 GAGAAAGGGGAGAGCCATGGGGG + Intronic
932298996 2:70651000-70651022 GAGGCTGCAGTGAGCCATGGTGG + Intronic
932386198 2:71335099-71335121 GAGGCCGCAGGGAACCATGGTGG - Intronic
932481243 2:72040694-72040716 TGGGCAGTAGGGAGCCATGGTGG - Intergenic
932598003 2:73106299-73106321 GAGGCAGATGGGTTCCATGATGG + Intronic
932866340 2:75347086-75347108 GAGGCAGGTGGGAGGAAGAGAGG - Intergenic
933728479 2:85439426-85439448 AAGGCACTGGGGAGCCATGGAGG + Intergenic
933849629 2:86355450-86355472 GAGGGAGCCGGGAGCCAGGGAGG + Intergenic
934556542 2:95289670-95289692 GAGGGAAGTGGGGGCCAGGGGGG - Exonic
934857416 2:97737911-97737933 GAGGCAGGTGGGCGGTGTGGTGG + Intronic
936233574 2:110724954-110724976 GAGGAAGGAAGGAGGCATGGAGG + Intergenic
937119144 2:119430152-119430174 AAAGCAGGTGGGGGCCACGGAGG + Intronic
937364468 2:121251025-121251047 GAGGCAGGTGGGATCACTTGTGG + Intronic
938139170 2:128782496-128782518 GATGGAGGAGGCAGCCATGGGGG + Intergenic
938185121 2:129224732-129224754 CAGGCAGTAGGGAGCCATGGAGG + Intergenic
938469076 2:131543572-131543594 GAAACAGGTGGCAGCCATGCCGG - Intergenic
938911463 2:135889252-135889274 TAGGCAGGTGGCAGGGATGGAGG - Intergenic
940207039 2:151214264-151214286 GAGGCTGGTGGGAGGCAGGTGGG + Intergenic
941753475 2:169159781-169159803 GATGCATGTGAGACCCATGGAGG - Intronic
941859168 2:170261254-170261276 GAGGCGGGTGGGATCCCTTGAGG - Intronic
942146226 2:173029705-173029727 ATGGCAGGTAGAAGCCATGGTGG + Intronic
942951666 2:181728810-181728832 GAGGCTGATGGGAGCCATGGAGG - Intergenic
944230691 2:197389070-197389092 GTGACAGTTGGGAGCCATGTTGG - Intergenic
944412601 2:199458340-199458362 GGGGCGGGTGGGAGGCAGGGAGG + Intronic
944681889 2:202084641-202084663 GAGACAGAAGGGAGCCAGGGAGG - Intronic
945923388 2:215778934-215778956 GAGACAGGTGGGAGGCAGGCAGG - Intergenic
945984116 2:216340567-216340589 GTTGCAGGTGGCAGCCCTGGGGG - Intronic
946202302 2:218077629-218077651 GGGGCAGGTGTTAGCCATGTGGG - Intronic
946238928 2:218342088-218342110 GAGGCAGGAGGGACCCTTGTAGG - Exonic
946285368 2:218698666-218698688 GAGAGAGGTGGGATCCATGAGGG - Exonic
946656862 2:221957975-221957997 GAGGCAGGTGGGATCACTTGAGG - Intergenic
947344764 2:229179275-229179297 GGGGCTGATGGGAGCCATGGAGG - Intronic
948454998 2:238100764-238100786 CAGGGAGGTGTGAGCCACGGAGG + Intronic
948643858 2:239391831-239391853 GAGGCACGTGGGAGCTGCGGAGG - Intronic
948857589 2:240737206-240737228 GGGGCAGGTGGGACCCTGGGGGG + Intronic
948930526 2:241129006-241129028 GAGAGAGGCGGGAGACATGGAGG - Intronic
948930532 2:241129029-241129051 GAGAGAGATGGGAGACATGGAGG - Intronic
948970045 2:241418389-241418411 GAGGCAGTGGGCAGCCCTGGGGG - Intronic
948987303 2:241533324-241533346 GAGGAAGGTGGGCGACCTGGAGG - Intergenic
949022310 2:241748573-241748595 GAGGACAGTGGCAGCCATGGTGG - Intronic
1169075992 20:2760076-2760098 GAGGCAGGTGAGAGGCCGGGCGG - Exonic
1169080090 20:2793096-2793118 GAGGCAGCAGTGAGCCATGATGG - Intergenic
1169144094 20:3241115-3241137 GAGGCAGGTGGGAGGACTGAAGG - Intergenic
1169926965 20:10793804-10793826 AAGGCCGGCGGGAGCCAGGGCGG - Intergenic
1170053800 20:12176529-12176551 GATGCAGGTGGGGCCCAAGGTGG + Intergenic
1170139936 20:13115632-13115654 GAGGCATGTGGGTGTCATGCTGG - Intronic
1171077839 20:22147254-22147276 ATGGCAGGTGGGAGGCCTGGGGG - Intergenic
1171263727 20:23753512-23753534 CAGGAAGGTGGGAGCCACAGAGG - Intergenic
1171272766 20:23829195-23829217 CAGGAAGGTGGGAGCCACAGAGG - Intergenic
1171437345 20:25133691-25133713 AAGACAAGTGGGAGCCATGGAGG - Intergenic
1171488494 20:25500385-25500407 GGGGTAAGTGGGCGCCATGGGGG + Intronic
1172178844 20:32988413-32988435 GAGGCCGGTGAGAGCCATTCAGG - Intronic
1172391397 20:34567780-34567802 GAGGAAGGAGGGAGCAAAGGAGG - Intronic
1172751728 20:37256206-37256228 GAGACACGTGGTAGGCATGGAGG + Intronic
1174196069 20:48773774-48773796 GGGTAAGGTGGGAGCCATGGAGG + Intronic
1174280744 20:49437364-49437386 GAGTGAAGTGGGAGCCGTGGAGG + Intronic
1174292958 20:49521941-49521963 GGGTCAGGTGGTGGCCATGGAGG - Intronic
1174305297 20:49610704-49610726 GAGTGAGCTGGGAGTCATGGAGG + Intergenic
1174401239 20:50277094-50277116 GAGTGAGTTGGGAGCCATAGAGG - Intergenic
1174421267 20:50400554-50400576 GGGGTAGGTGAGAGCCATGGAGG + Intergenic
1174428126 20:50447898-50447920 AAGTGAGGTGGGAGCCGTGGAGG + Intergenic
1174648315 20:52104463-52104485 GAGCGAAGTGGGAGCCGTGGTGG - Intronic
1175077705 20:56390057-56390079 GATTGAGTTGGGAGCCATGGGGG - Intronic
1175250753 20:57609027-57609049 AAGGCAATTGGAAGCCATGGGGG - Intronic
1175269447 20:57723545-57723567 GAGGCAGGTGGGACCCCAGTGGG + Intergenic
1175377610 20:58540119-58540141 GATGAAGGTGGGTACCATGGTGG - Intergenic
1175834187 20:61982859-61982881 CAGGCTGGGAGGAGCCATGGAGG - Intronic
1175903973 20:62370912-62370934 GAGGCAGGTGGCAGCCCTGGGGG - Intergenic
1175915684 20:62424714-62424736 GAGGGAGGTGGGAGTCCTGAGGG - Intronic
1176030412 20:63008711-63008733 AGGGCTGGTGGGGGCCATGGGGG + Intergenic
1176051108 20:63120192-63120214 GGGGCAGCTGGGAGCCTGGGAGG - Intergenic
1176096042 20:63345038-63345060 GAGGCAGGTGTGGGCAATGTGGG + Exonic
1176368353 21:6047148-6047170 GAGGCAGTTGGGAACTTTGGTGG + Intergenic
1178811162 21:35882780-35882802 GCGGCATCTGGGAGCCAGGGTGG - Intronic
1178839380 21:36126627-36126649 GAGGCTGTTGAGTGCCATGGGGG - Intergenic
1179297927 21:40079796-40079818 TAGGAAGGTGGGAGCAAGGGTGG + Intronic
1179537128 21:42059989-42060011 GAGGCTGGAGGGCGCCATAGGGG + Intergenic
1179633066 21:42690676-42690698 GAGGCAGGCTGGAGGCAGGGAGG - Intronic
1179637871 21:42725129-42725151 GCGGCAGGTGGGATCCTTGTGGG - Intronic
1179755166 21:43491394-43491416 GAGGCAGTTGGGAACTTTGGTGG - Intergenic
1179982917 21:44905792-44905814 GAGGCAGCTGGGAGACAGTGAGG - Intronic
1180066599 21:45415556-45415578 GATGCAGGTGGGAACCAGCGTGG + Intronic
1180101690 21:45590615-45590637 GAGGCGGGGCGGAGGCATGGGGG + Intergenic
1181572488 22:23775140-23775162 GAGACAGGGGGAAGCCCTGGAGG + Intronic
1181765961 22:25092419-25092441 GAAGCAAGTGGGAGCCTTGTGGG + Intronic
1181907690 22:26212485-26212507 GAGGCAGCAGTGAGCCATGATGG - Intronic
1182043865 22:27259385-27259407 GAGGCAGGAGGAAGGCAGGGTGG - Intergenic
1182116527 22:27759689-27759711 GAAGCAGGTGGGAGCCACATGGG - Intronic
1182192426 22:28476132-28476154 GAGGCAGGTAGATGGCATGGGGG - Intronic
1182328895 22:29536324-29536346 GAGGCCGGTGGGGGCCATGCAGG + Intronic
1182459220 22:30472207-30472229 GAGGCAGCTGGGAGGAAGGGAGG + Intergenic
1182686491 22:32124236-32124258 AAGGCAGGTGGGAGCACTGTGGG + Intergenic
1182715201 22:32352656-32352678 AAGGCAGGTCGGAGCGTTGGGGG - Intergenic
1182930144 22:34165894-34165916 GAGGAGGATGGGAGCCAAGGGGG + Intergenic
1183085843 22:35486500-35486522 GAGGCAGCTGGAAGCCAGGAGGG - Intergenic
1183310593 22:37107492-37107514 GATGATGGTGGGAGTCATGGGGG - Intronic
1183362331 22:37389253-37389275 GGGGCCAGTGGGAGCCATTGTGG - Intronic
1183439664 22:37816047-37816069 GAGGCAGAGGGGAGCCAGGCAGG - Intronic
1183527826 22:38334512-38334534 GAGGGAGTTAGGAGCCCTGGGGG + Intronic
1183638930 22:39081764-39081786 AAAGCAGGTGGGAGGCAGGGAGG - Intronic
1183663327 22:39233995-39234017 TGGGCAGGCGGGAGCCACGGAGG + Intronic
1183676929 22:39304366-39304388 GAGGCTGGGGAGGGCCATGGTGG + Intergenic
1183678442 22:39312822-39312844 GAGGCAGATGGGGGCCCTTGAGG - Intergenic
1183744673 22:39685735-39685757 GGGGGAGGTGGGAGCCGTGGAGG - Intronic
1183774868 22:39957425-39957447 GAGGCAGGTGGATGCGGTGGGGG - Intronic
1183949308 22:41343783-41343805 GAGGCAGGTGGGACACATTTGGG + Intronic
1183981048 22:41540446-41540468 GAGGGTGGTGGGAGTCCTGGAGG - Intronic
1184151921 22:42644327-42644349 TAGGCAGTGGGGAGCTATGGTGG - Intronic
1184358304 22:43997142-43997164 GAGGCAAGAGGGAGAGATGGGGG - Intronic
1184493721 22:44825424-44825446 GGGGCAGCTGGCAGCCACGGAGG - Intronic
1184648823 22:45910382-45910404 GTGGCAGCTGGGAGACACGGTGG + Intergenic
1184732394 22:46377993-46378015 GAGGGAGGTGGGAGCCAGCCTGG - Intronic
1184735517 22:46395488-46395510 GAGGGAGGTGGGAGCCAGTGTGG - Intronic
1184736031 22:46398276-46398298 GGGGCAGGTGGCTGGCATGGCGG + Intronic
1184762889 22:46554947-46554969 GAGCAAGGTGAGAGCCATGTTGG + Intergenic
1184776824 22:46627501-46627523 GAGCCAGGCGGGAGCCAGGCAGG + Intronic
1184818816 22:46893341-46893363 GAGGCAGGCGGGATGGATGGAGG + Intronic
1184887888 22:47357532-47357554 GAGGCAGTTGAGGCCCATGGAGG + Intergenic
1184987572 22:48146030-48146052 GAGGCAGGAGGGAGGCAGGAAGG - Intergenic
1185289311 22:50015779-50015801 GAAGCAGGTGGGCTCCATGCAGG - Intronic
1185342309 22:50297146-50297168 GACGGAGGTGGCAGCCATGGCGG + Intronic
949404603 3:3701150-3701172 GAGGCAGGAGGAAGGCATGATGG - Intronic
950099425 3:10347919-10347941 GAGGAAGGTGTGGTCCATGGTGG - Intronic
950203839 3:11062902-11062924 CAGGCAGAAGGGAGCCAAGGGGG + Intergenic
950543437 3:13625523-13625545 GGGGAAGGTGGGAGCCCTGCTGG - Intronic
950563398 3:13749091-13749113 GAGGAAGGTGGGAGCCATGGAGG - Intergenic
950664094 3:14484428-14484450 GGGGAAGGTGGGAGCCATGGAGG + Intronic
950707095 3:14789640-14789662 GATTGAGGTGGGAGCCATGGAGG + Intergenic
950768024 3:15288415-15288437 GAGGCAGTAGGGAGGGATGGAGG + Intronic
951703878 3:25524621-25524643 GAGGAAGGAGGGAGGCAGGGAGG - Intronic
952007211 3:28855685-28855707 GAGGCTGGTATGAGCCATGACGG - Intergenic
952858775 3:37794991-37795013 GAGGGAGGAGGGAGACAGGGTGG - Intronic
952879309 3:37973427-37973449 GGGGCAGGTGGGAGCCATCCAGG - Intronic
952882678 3:37994485-37994507 GGGGCAGGAGGGAGCCGTGGAGG + Intronic
953352203 3:42223781-42223803 GAGGGAGGTGGGAGCAAGAGAGG - Exonic
953418902 3:42739675-42739697 GAGTCAGATGGGAACCCTGGTGG - Exonic
953771107 3:45779230-45779252 GAAGCAGGTGGGGGCAGTGGAGG + Intronic
953927347 3:46989209-46989231 GAGGCAGGCGGTAGCCATGGCGG + Intronic
954670052 3:52285965-52285987 GAGGCAGGTGGGATCATTTGAGG - Intronic
954743713 3:52774704-52774726 GTGGGAGGTGGGGGCCAGGGTGG - Intergenic
954844830 3:53546262-53546284 GAGGGAGGTGTGGGCCCTGGGGG + Intronic
955195639 3:56802309-56802331 GAGGCAGGAAGGAGCCTGGGGGG + Intronic
955747646 3:62155894-62155916 GGGGCTGGTGGAAGCCATGAAGG + Intronic
955885799 3:63596678-63596700 GAGGAATGTGGGAGGCATGCTGG + Intronic
957021592 3:75134370-75134392 GAGGGTTGTGGAAGCCATGGTGG + Intergenic
957068495 3:75546469-75546491 GAGGCAGCAGTGAGCCATGATGG + Intergenic
957194601 3:77051324-77051346 CAGGGAGGTGGGAGGCAAGGGGG - Intronic
958622862 3:96583988-96584010 GATGCAGGTGGGAGCCATTCAGG - Intergenic
959105893 3:102063849-102063871 TAGGAAGGTGGGGGACATGGAGG - Intergenic
959383990 3:105678526-105678548 GGGGGAGGTGGGAGAGATGGAGG + Exonic
960145381 3:114195134-114195156 GATGAAGATGGGAGCCATGGAGG + Intronic
960595717 3:119406151-119406173 GAGGCAATAGGGAGCCATTGAGG + Intronic
960710020 3:120518754-120518776 GAGGACTGTGGCAGCCATGGAGG - Intergenic
960987387 3:123289877-123289899 GAGGCCGGAGGCAGCCATGTAGG + Exonic
961035480 3:123638728-123638750 GAGGCAGGAGGGAGGAACGGTGG - Intronic
961314215 3:126023431-126023453 GAGGGAGCTGGGAGCACTGGAGG + Intronic
961361455 3:126370738-126370760 CTGTCAGGTGGGAGCCTTGGTGG + Intergenic
961458978 3:127038328-127038350 GAGGCTGGTGGGAGACAGGTGGG - Intergenic
962060896 3:131926163-131926185 GAGGCAGGTGTGAGTCAGAGGGG + Intronic
962940262 3:140119003-140119025 CAGGCAGGTGGGATCCAAGGAGG + Intronic
963602657 3:147391441-147391463 GAGGAAGGCGGGAGGGATGGAGG - Intronic
964469879 3:157041312-157041334 GAGCAAGATGGGAGCCAGGGAGG - Intronic
966414259 3:179672952-179672974 GAGGCAGGTAGGATCCAAGGTGG + Intronic
966926048 3:184645309-184645331 GGGGCAGGTGGAAGGCCTGGTGG - Intronic
967154418 3:186679459-186679481 GAGAAAGGTGAGACCCATGGAGG + Intergenic
968112825 3:196063462-196063484 GAGGGAAGTGGGAGGGATGGAGG - Intronic
968271523 3:197407074-197407096 GAGGCGTGAGGGAGCAATGGGGG - Intergenic
968321965 3:197777777-197777799 GAGGCAGCAGTGAGCTATGGTGG - Intronic
968432806 4:568543-568565 CAGGCACCTGGGAGCCAGGGAGG - Intergenic
968477603 4:819697-819719 GAGGAAGGTGGGGGCCAGGGTGG - Intronic
968581422 4:1397088-1397110 GAGGCAGGTGGGGGCCACAGTGG + Intergenic
968628395 4:1638120-1638142 GAGGCCGGGGGCAGCCTTGGGGG - Intronic
968763083 4:2452340-2452362 GGAGCAGGTGGGTGCCATGCAGG + Exonic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
968894053 4:3388563-3388585 GGGGTGGGTGGGAGCCAGGGTGG - Intronic
968982912 4:3860350-3860372 GACGCGGGTGTGAGCCAGGGAGG - Intergenic
969255659 4:6000039-6000061 GAGGCCGTGGGCAGCCATGGTGG + Intergenic
969818718 4:9705022-9705044 GGGGTGGGTGGGAGCCCTGGTGG - Intergenic
970261406 4:14228673-14228695 GAGCCAGGTTGGGGCCATGTTGG + Intergenic
970360493 4:15304148-15304170 GAGGCAGCAGGTAGGCATGGTGG + Intergenic
971158411 4:24107730-24107752 CAGGCAATAGGGAGCCATGGAGG + Intergenic
971740409 4:30512493-30512515 GTAGCAGCTGGGAGCCCTGGAGG + Intergenic
971835649 4:31759901-31759923 GAGGAAGCTGTGAGCCTTGGGGG + Intergenic
972421253 4:38888750-38888772 GAAGGAGGTGGGAGTTATGGGGG + Intronic
972543233 4:40057037-40057059 GCGGCGGGTGGGAGGCAGGGAGG + Intronic
973362555 4:49178450-49178472 GAAGCTGGTGGGAGCCAGGAAGG - Intergenic
973895652 4:55410075-55410097 AAGGCTGGTGGGAGGCAAGGAGG - Intronic
974050532 4:56937603-56937625 GAGGCAGAAGTGAGCCATGATGG - Intergenic
976177965 4:82373585-82373607 CGAGCAGGAGGGAGCCATGGTGG - Exonic
976183004 4:82416846-82416868 GGGACAGGGGGCAGCCATGGTGG - Intergenic
976623789 4:87156397-87156419 GAGGCAGGTGGGGGTCGTGGGGG + Intergenic
979295703 4:119030714-119030736 GGGGCAGGCTGGGGCCATGGAGG - Exonic
980018095 4:127676605-127676627 GAGAGAGGTGGGAGCCAAGATGG + Intronic
981427910 4:144625024-144625046 TAGGCAGGTAGGATCCATGAGGG - Intergenic
982009920 4:151096813-151096835 GAGGCAGCAGTGAGCCATGATGG - Intergenic
982094910 4:151912705-151912727 GAGGCAGGTGAGGGGAATGGAGG + Intergenic
982216957 4:153090900-153090922 GAGGCTGGTTGGTGCCATGGGGG - Intergenic
982371958 4:154643211-154643233 GAGACAGGTGGGAGCAAGAGGGG + Intronic
985345752 4:189002358-189002380 GAGACAGGACGGAGCCCTGGAGG - Intergenic
985631541 5:1016685-1016707 AGGGCAGGTGGGAGCCCTGGAGG - Intronic
985915508 5:2915672-2915694 GAGAGTGCTGGGAGCCATGGTGG + Intergenic
986127236 5:4894413-4894435 GAAGCGGGTGGGAGTCATGGGGG + Intergenic
986527218 5:8692829-8692851 GAGGCAGGTGTGAACCCGGGAGG + Intergenic
987159222 5:15123511-15123533 GAGGCTGGTTGGAGCCAGAGTGG - Intergenic
987300938 5:16597707-16597729 GGGGCATGTGGGAGACATGTTGG - Intronic
988780745 5:34519504-34519526 GAGGATGGTGGGATCCATGATGG - Intergenic
989410106 5:41110446-41110468 GAGGCAGGTGGGATCACTTGAGG - Intergenic
989855983 5:46292004-46292026 GGGATACGTGGGAGCCATGGAGG - Intergenic
990654153 5:57935849-57935871 GATAAAGGTGGGAGCCATGGAGG - Intergenic
991608802 5:68429369-68429391 GGGGCAGGATGGAGACATGGGGG - Intergenic
992161329 5:74006531-74006553 GAGGGAGGAGGGAGAAATGGGGG - Intergenic
993627658 5:90245199-90245221 GAGTAAGGTGGGAGCAATGTAGG - Intergenic
993638077 5:90369986-90370008 GAGGCAGGAGGGTGCCAGGAGGG + Intergenic
993660193 5:90623698-90623720 GGGGCAGGGGGAAGGCATGGTGG - Intronic
996058774 5:119009812-119009834 GAGGGTGGCGGGAGCCATGGGGG + Intergenic
997243704 5:132328178-132328200 GAGGCAGGTCCAAGCCAGGGAGG + Intronic
997361720 5:133299470-133299492 CTGGCAGGTGGGAGGCAGGGAGG + Intronic
997667437 5:135642981-135643003 CAGGCCAGTGGGAGCCAGGGCGG + Intergenic
998109251 5:139488414-139488436 GAGGAAGCTGAGGGCCATGGAGG + Intergenic
998134928 5:139669523-139669545 CTGGCAGGTGTGAGCCATGCTGG - Intronic
999021918 5:148175440-148175462 GAGGGAGATTGGAGACATGGAGG - Intergenic
999310172 5:150546724-150546746 GAGGCAGGTGCCAGCCCTGCGGG - Intronic
999722827 5:154411547-154411569 GAGGAAGGGGAGAGGCATGGTGG + Intronic
999741315 5:154555637-154555659 GAGTAAGGTGGTAGCCATTGTGG - Intergenic
1000080517 5:157841199-157841221 GAGGCAGCAGTGAGCCATGATGG + Intronic
1001035242 5:168292309-168292331 GGGGCAGGTGGGGGCCCAGGCGG - Intronic
1001245263 5:170101363-170101385 GAGGCAGGTGGGAGCCAGCCTGG - Intergenic
1001284460 5:170412379-170412401 CAGGCAGGAGGCAGCCATTGAGG + Intronic
1001313577 5:170627731-170627753 GAGGCTTGTAGGAGCCAAGGTGG + Intronic
1001333964 5:170782837-170782859 GAGGGAGCTGGGAGCCAGGAGGG - Exonic
1001825739 5:174743451-174743473 GAGGGAGGTGGGAGGGAGGGAGG - Intergenic
1001965812 5:175909129-175909151 ATGGCAGGTGGGGGACATGGAGG - Intergenic
1001975664 5:175996675-175996697 GTGGCAGGTGGGGGCACTGGTGG - Intronic
1002047934 5:176552516-176552538 GCAGCCAGTGGGAGCCATGGAGG + Intronic
1002185507 5:177452982-177453004 GATGTAAGTGGCAGCCATGGGGG - Intronic
1002195088 5:177497089-177497111 GAGGCTGCTGGGAGCCAGGGCGG + Intronic
1002241764 5:177847097-177847119 GTGGCAGGTGGGGGCACTGGTGG + Intergenic
1002251134 5:177930071-177930093 ATGGCAGGTGGGGGACATGGAGG + Intergenic
1002455986 5:179345531-179345553 GAGGCAGGCGGGAGGGAGGGAGG + Intergenic
1002805860 6:573387-573409 GAGGCAGGTGGGAGGCAGCAGGG - Intronic
1002878524 6:1232514-1232536 GAGGCGGGTGGGTGACATGTGGG - Intergenic
1003051283 6:2783124-2783146 GAGGCAGGAGGGAGGAAAGGTGG - Intronic
1003619418 6:7684870-7684892 GAGGCTGCAGTGAGCCATGGTGG + Intergenic
1003869651 6:10391366-10391388 GGGGCAGGTGGGACCCAGTGAGG + Intergenic
1004021187 6:11776842-11776864 GAGGCAGGAGGGAGCCACTGTGG + Intronic
1004623843 6:17356082-17356104 GAGGCTGGAGTGAGCCATGGTGG + Intergenic
1005856090 6:29864177-29864199 TAGGCAGGAGGGAGCCCGGGAGG + Intergenic
1006174870 6:32115759-32115781 GGGGCTGGTGGGAGGCCTGGTGG + Exonic
1006481412 6:34297506-34297528 GGGGCAGATGAGAGCCTTGGGGG + Intronic
1006749822 6:36369839-36369861 GAGGCAGCAGTGAGCTATGGTGG + Intronic
1006750388 6:36373253-36373275 TGGGGAGGTGGGAGGCATGGAGG + Intronic
1007344914 6:41222341-41222363 GAAGCAGGAGGGAGACCTGGTGG + Intergenic
1007625515 6:43244052-43244074 AAGGCAGGTGGGAGGCATGGAGG - Intronic
1007907147 6:45473261-45473283 TTGGCAGGTGGGAGGAATGGGGG - Intronic
1008937182 6:57004527-57004549 GGGGCATGTGGTAGTCATGGCGG - Intronic
1009446596 6:63749798-63749820 GAGGAAGTTGGGACCCCTGGAGG - Intronic
1009959804 6:70504874-70504896 GAGGCAGGTGGTAGAGGTGGAGG + Intronic
1010801166 6:80177161-80177183 GAGGCTGCAGTGAGCCATGGTGG + Intronic
1011534437 6:88360802-88360824 GAGGCAGGTGGGAGACAGGGAGG - Intergenic
1013404973 6:109834994-109835016 TAGACAGTTGGGACCCATGGAGG + Intergenic
1013787960 6:113803912-113803934 GAGGCTGCAGTGAGCCATGGTGG - Intergenic
1015315638 6:131813270-131813292 GAGGCAGGTGGGATCATTTGAGG + Intronic
1016531018 6:145058250-145058272 GATGCTGGTGGGAGCCCTGCAGG - Intergenic
1017297192 6:152811867-152811889 GAGGAAGGAGGGAGCGAGGGAGG - Intergenic
1018945495 6:168345091-168345113 CAAGCAGGTGGGTGCCGTGGAGG + Intergenic
1019083196 6:169450267-169450289 CAGGCAGCAGGGAGCCCTGGAGG + Intergenic
1019289924 7:245427-245449 GAGGCAGGGGCCAGCCTTGGTGG + Intronic
1019739907 7:2667526-2667548 GAGGGAGGTGGGAGCCATGAAGG + Intergenic
1019812782 7:3176661-3176683 GAGGCAGGTGGGGGGTCTGGTGG + Intergenic
1019979264 7:4609111-4609133 GAGGCTGCAGTGAGCCATGGTGG + Intergenic
1021247628 7:18283241-18283263 GTGGCAGGAGGGAGCAAAGGGGG + Intronic
1021980269 7:26047458-26047480 GAGACAAGAGGGAGCCATTGTGG + Intergenic
1022436362 7:30389744-30389766 GAGTAAGATGGGAGCCAAGGGGG - Intronic
1023638430 7:42236522-42236544 GAAGGAGGCGGGAGGCATGGTGG - Intronic
1023743715 7:43303061-43303083 GAGGAAGGTGGCAGCCAGGAGGG - Intronic
1023874950 7:44281871-44281893 GAGGCAGGTGGGGGTCCTGGAGG - Intronic
1024548291 7:50540101-50540123 CTGGCAGCTGGGAGCCATGGGGG - Intronic
1026155364 7:67821253-67821275 GAGGCAGGTGGGAACTGTGGGGG + Intergenic
1026320001 7:69259983-69260005 GAGGCGGGAGGGAGCTTTGGGGG - Intergenic
1026570986 7:71530636-71530658 GAGGCAGGAGGCAGCCAAGATGG - Intronic
1026771709 7:73205580-73205602 GAGCCAGGTGGGAGCCTTCCCGG + Intergenic
1026831046 7:73610359-73610381 GAGGTAGTAGGGAGCCATGGAGG - Intronic
1026977543 7:74507715-74507737 TGGGCAGTAGGGAGCCATGGAGG + Intronic
1027012577 7:74758977-74758999 GAGCCAGGTGGGAGCCTTCCCGG + Intronic
1027075463 7:75187076-75187098 GAGCCAGGTGGGAGCCTTCCCGG - Intergenic
1029344982 7:99971839-99971861 GAGACAGGTGGAAGGAATGGAGG - Exonic
1029480008 7:100806636-100806658 GAGGCAGGTGGGGGACTGGGGGG - Intronic
1029488411 7:100857097-100857119 GCGGCAGGGAGGAGCCATTGGGG - Exonic
1029698516 7:102230418-102230440 GAGGCAGCAGTGAGCCACGGTGG + Intronic
1029742917 7:102501155-102501177 GCTGCAGGAGGGGGCCATGGAGG - Exonic
1029760907 7:102600316-102600338 GCTGCAGGAGGGGGCCATGGAGG - Exonic
1030147066 7:106367644-106367666 GGGGTAGGTGGGAGGCATGGTGG + Intergenic
1030216895 7:107053060-107053082 GAGGCAGGTGGGATCACTTGAGG - Intronic
1032066935 7:128778902-128778924 GCCGCAGGTGGGAGTCCTGGTGG + Intergenic
1032074046 7:128827888-128827910 GAGGCCGGAGGAAGCCAGGGAGG - Intergenic
1032403722 7:131641085-131641107 AAGGCAGGGGGGTCCCATGGAGG - Intergenic
1032490635 7:132321653-132321675 CAGGCAGGAGGGAGCCCCGGGGG + Intronic
1032637321 7:133723862-133723884 GAGGCAGGTGGGAGGACTGTTGG - Intronic
1032861830 7:135887234-135887256 GAGGCAGGAGGGAGAGAAGGGGG + Intergenic
1033243325 7:139699168-139699190 CAGGCTGGTGGGAGAGATGGCGG - Intronic
1033274701 7:139962595-139962617 GAGGCAGGTGTGAGCCAGAAAGG + Intronic
1033354186 7:140586154-140586176 GAAGCTGGTGGCAGCCATTGTGG + Intronic
1034278447 7:149834942-149834964 GTGGCAGGTGGGAGTCAGGGAGG - Intergenic
1034404916 7:150896804-150896826 GTGGAAGCTGGGAGCCCTGGGGG + Intergenic
1034469460 7:151247737-151247759 AAGGCACGTGGGAGCCCGGGAGG - Intronic
1034950247 7:155291900-155291922 GAAGTAGGTGGGAGAGATGGGGG - Intergenic
1035039360 7:155916362-155916384 GATGGTGGTGGCAGCCATGGAGG - Intergenic
1035075021 7:156171572-156171594 GAGGCAGGTGGCAGCCACACTGG + Intergenic
1035374074 7:158395834-158395856 GGGGCTGGTGGGATCCAAGGCGG - Intronic
1035418396 7:158707608-158707630 GTTGCAGGTGGGAGCCAAAGTGG - Intergenic
1035453726 7:158996202-158996224 GAGGCAGCCCGGAGCCATCGCGG + Intergenic
1036503037 8:9330826-9330848 GAGGCAGGTGGGAAGTAGGGCGG - Intergenic
1036559590 8:9890281-9890303 GAGGCAGGTGGGATCTGGGGTGG - Intergenic
1036683095 8:10890281-10890303 AGGGCAGGTGGGAGCCCAGGAGG - Intergenic
1036773186 8:11592700-11592722 GAGGCAGGTGGCAGGCAGGATGG - Intergenic
1037608691 8:20458596-20458618 AAGGCAGGTGGGAGCTTTTGAGG + Intergenic
1037804475 8:22051324-22051346 GAGGCAGAGGGGAGCCAAGCAGG + Intronic
1038627366 8:29207081-29207103 GAGGGAGTTGGGAGCCATTGAGG - Intronic
1038687557 8:29732382-29732404 TAGGCAGGTGGGAGCCCAGAGGG - Intergenic
1038954113 8:32448748-32448770 GTGGCAGGGGGGACCCCTGGGGG - Intronic
1039709681 8:40043045-40043067 GAGGCTGATGTGAGCTATGGTGG + Intergenic
1039745321 8:40420390-40420412 GAGGCAGGTGGGGAGCATGGTGG + Intergenic
1041782359 8:61591051-61591073 GAGGAAGGTGGGAGTGAGGGGGG - Intronic
1042595888 8:70447747-70447769 GAGGCTGCAGTGAGCCATGGTGG - Intergenic
1042934356 8:74043896-74043918 GAGGCTGCAGTGAGCCATGGTGG - Intergenic
1045412022 8:101929380-101929402 GAGGAGGGAGGGAGGCATGGAGG + Intronic
1045649151 8:104326656-104326678 GTGGCAGGTTGCAGACATGGAGG - Intergenic
1046181021 8:110647780-110647802 GAGGCAGGAGGGAGGCATGGAGG + Intergenic
1047023892 8:120806894-120806916 GAGGAAGATGGGAGCAAGGGAGG - Intronic
1047669830 8:127133598-127133620 GAGGCAGGTGGGGGCTAGGAGGG + Intergenic
1047720799 8:127637412-127637434 GAAGCAAGTGGTACCCATGGGGG + Intergenic
1047724481 8:127672044-127672066 GAGTGAGGTGGGAGCCACTGGGG - Intergenic
1047917367 8:129596305-129596327 GAGGCAGGAGAGAGAGATGGGGG - Intergenic
1047927636 8:129696992-129697014 GAGGGAGGTGGGAGAGAGGGAGG + Intergenic
1048006961 8:130427285-130427307 GAGGAAGGGGTGAGACATGGTGG - Intronic
1048026942 8:130596004-130596026 TAGGGAAGTGGGAGCCCTGGTGG - Intergenic
1048313365 8:133343469-133343491 TAGGCAATTGGGAGCCATTGAGG + Intergenic
1048615155 8:136066155-136066177 GAGGCAGGTAGGAGGGATGTGGG + Intergenic
1049055622 8:140234369-140234391 GTGGCTGGTGGCTGCCATGGTGG + Intronic
1049405571 8:142450521-142450543 GTGGCTGTTGGGGGCCATGGGGG - Intronic
1049406802 8:142455236-142455258 GAGGCGAGTGGGAGTGATGGGGG - Intronic
1049419027 8:142508758-142508780 GAGGCACGTGGGAGCCTGGAAGG - Intronic
1049661621 8:143822098-143822120 GAGGCAGGCAGGTGCCCTGGAGG + Intronic
1049664191 8:143835733-143835755 GCGGAAGGAGGGAGGCATGGGGG + Intronic
1049827434 8:144678600-144678622 GAGGCACTGGGGAGCCAGGGAGG + Intergenic
1049858382 8:144879503-144879525 GAGGCAGCGGTGAGCCATGATGG + Exonic
1049985419 9:946469-946491 GAGGGAGGAGAGAGCCACGGTGG - Intronic
1052049722 9:23831279-23831301 GAGGGAGGTGGGGGGCAGGGCGG - Intergenic
1052973749 9:34397559-34397581 GATGGAGGTGGGAGCCCTGTAGG + Exonic
1053070908 9:35101410-35101432 GATGCAGGTGGGGGCCAAGGAGG - Exonic
1053412982 9:37927792-37927814 GAGGCTGGTGGGAACCCTGAGGG - Intronic
1053434338 9:38065599-38065621 GAGGGAGGAGGCAGCCAGGGAGG - Intronic
1054860633 9:69949243-69949265 GAAGCAGGTGAGAGCCATGATGG + Intergenic
1055690642 9:78826722-78826744 GAGGCAGGTGGCAGCCAGATGGG + Intergenic
1055824202 9:80304335-80304357 TTGGCAGGTGGCAGACATGGAGG + Intergenic
1055938752 9:81628390-81628412 GAGGCCTATGGGAACCATGGCGG - Intronic
1056679148 9:88701920-88701942 GAGGCAGGAGGGTGGCCTGGGGG + Intergenic
1056795274 9:89654920-89654942 GTGGCAGGAGGGGGCCAAGGAGG - Intergenic
1056837659 9:89970287-89970309 GACTCAGGTGAGAGACATGGAGG - Intergenic
1057188980 9:93075752-93075774 CAGGCAGGTATGAGGCATGGCGG - Intronic
1057383484 9:94588875-94588897 AAGGCAGGTGTGTGCCTTGGAGG - Intronic
1057641493 9:96827392-96827414 GAGGCTGCAGTGAGCCATGGTGG - Intronic
1057801659 9:98194924-98194946 GATGCAGGTGCAAGCCTTGGAGG - Intergenic
1057854154 9:98589777-98589799 GAGGCTGCTGTGAGCCATGATGG - Intronic
1059153911 9:111973179-111973201 GGGGCAGGTGGGGGCCGTTGAGG + Intergenic
1059310396 9:113384911-113384933 GAGGCAGGAGCGAGCCCAGGAGG - Intergenic
1059570643 9:115430824-115430846 GTGGCAGGTGGGAGACATTGGGG - Intergenic
1060044188 9:120327142-120327164 GAGGCAATGGGGAGCCATTGAGG + Intergenic
1060109190 9:120894514-120894536 GAGGCGGGTGGGAGGCGTCGTGG - Intronic
1060109641 9:120897316-120897338 GAGGCAGATGGGAGTCAGGGAGG + Intergenic
1060150633 9:121286118-121286140 GAGGCTGGGGGGAGCTATGTGGG - Intronic
1060157106 9:121327476-121327498 GAGCCAGGTAGGAGCCGGGGTGG + Exonic
1060172501 9:121473516-121473538 GAGGCATTTGGCAGCCATTGTGG + Intergenic
1060415457 9:123426539-123426561 GAGGCAGAATGGAGCCAGGGAGG + Intronic
1060548450 9:124474318-124474340 GGGGTAGTTGGGAGCCATGCAGG + Intronic
1060585168 9:124781059-124781081 GAGGGAGTAGGGATCCATGGAGG + Intronic
1060985425 9:127816665-127816687 GAGGCAGGGGTGAGGGATGGGGG - Intronic
1061218989 9:129238008-129238030 CAGGGAGGTGGGAGCCAGGCAGG - Intergenic
1061244576 9:129394824-129394846 GAGGCGGCTGAGAGCCGTGGGGG + Intergenic
1061313454 9:129778871-129778893 GAGGCTGCAGGGAGCCATGATGG + Intergenic
1061411519 9:130424684-130424706 GGGGCAGTGGGGAGCCATGACGG + Intronic
1061505991 9:131032180-131032202 GAGGGAGGAGGGAGGCAGGGTGG + Intronic
1061672629 9:132197663-132197685 CAGGCAACGGGGAGCCATGGAGG + Intronic
1061847769 9:133397486-133397508 TAGGTAGTTGGGAGCTATGGAGG - Intronic
1061898664 9:133661974-133661996 GGTGCACTTGGGAGCCATGGCGG + Intergenic
1061949877 9:133930270-133930292 GAGGCAGGGTGGAGGCAGGGAGG - Intronic
1062221437 9:135418184-135418206 GAGGCAGGTGAAGGCCTTGGTGG + Intergenic
1062290115 9:135790619-135790641 CAGCCAGGTGGGGGCCATGCTGG - Intronic
1062397515 9:136358413-136358435 GAGGAAGCTGAGGGCCATGGGGG - Exonic
1062413101 9:136434543-136434565 GGTGCAGGTGGGAGCTCTGGGGG + Intronic
1062481387 9:136754093-136754115 TGGGCAGTGGGGAGCCATGGAGG + Intergenic
1062591706 9:137277437-137277459 GGGGGAGGTGGGGGCCCTGGAGG + Intergenic
1185944677 X:4361969-4361991 GAGGGTGGTGGGAGGGATGGGGG - Intergenic
1186291867 X:8109088-8109110 GAGGAAGGAGGGAGGCAGGGAGG - Intergenic
1186872530 X:13786568-13786590 GGGGCAGGTGGAAGCCGGGGAGG - Intronic
1187087205 X:16052891-16052913 GAGGTAGGAGAGAGCCTTGGGGG - Intergenic
1187454479 X:19429191-19429213 CAGGGAGCAGGGAGCCATGGTGG + Intronic
1189377331 X:40475916-40475938 GAGGCAGGTGCGGGGCAGGGTGG - Intergenic
1189386907 X:40544705-40544727 GAGGCAGGTAGGAGAGAAGGGGG - Intergenic
1189423120 X:40874489-40874511 TCTGCATGTGGGAGCCATGGGGG - Intergenic
1190731990 X:53232722-53232744 GAGGGAGGTGGGAGTGAGGGAGG - Intergenic
1190823126 X:53993114-53993136 GAGGCAAGATGGAGCCCTGGTGG + Intronic
1191669433 X:63735392-63735414 CATGCATGTGGGAGTCATGGAGG - Intronic
1192162659 X:68800262-68800284 GAGTTGGGTTGGAGCCATGGTGG - Intergenic
1192201486 X:69069194-69069216 TGGGCAGGTGGCAGCTATGGAGG - Intergenic
1192848728 X:74931313-74931335 GAGCAAGGTGGGAGCTGTGGTGG + Intergenic
1193659172 X:84236417-84236439 GTGGCAGGTGTGATGCATGGGGG + Intergenic
1194478272 X:94388093-94388115 GAGGCAGGTGGGGGAAGTGGAGG + Intergenic
1197225660 X:123953873-123953895 GAGGCTGGTTTGAGCCCTGGAGG - Intergenic
1197639293 X:128950414-128950436 GGGGCAGTGGGGAGCCATTGAGG - Intergenic
1197719478 X:129735402-129735424 GAGGGCAGTGGGAGCCATGGAGG + Intergenic
1197865366 X:131011224-131011246 GAGGCAGATGGGAGCCAAGAGGG - Intergenic
1198106865 X:133470230-133470252 GAGGGAGCTGTGAGCCATGATGG + Intergenic
1198486636 X:137094025-137094047 CAGGAAGCTGGGAGCCAGGGAGG + Intergenic
1200228562 X:154432676-154432698 GAGGCAGATGTGAGCCCTGCGGG + Intronic
1200659095 Y:5939835-5939857 GAGGCAGGTTGGGGGAATGGGGG + Intergenic
1200807029 Y:7443565-7443587 GAGGGAGGTGGGAGGGAGGGAGG - Intergenic
1200992245 Y:9356392-9356414 GAGCCAGGTGGGAGGCACGTGGG - Intergenic
1200994894 Y:9376670-9376692 GAGCCAGGTGGGAGGCACGTGGG - Intronic
1200997559 Y:9397016-9397038 GAGCCAGGTGGGAGGCACGTGGG - Intergenic
1201000071 Y:9465552-9465574 GAGCCAGGTGGGAGGCACGTGGG - Intergenic
1201002732 Y:9485862-9485884 GAGCCAGGTGGGAGGCACGTGGG - Intronic
1201005387 Y:9506146-9506168 GAGCCAGGTGGGAGGCACGTGGG - Intergenic
1201008050 Y:9526475-9526497 GAGCCAGGTGGGAGGCACGTGGG - Intergenic
1201010664 Y:9546665-9546687 GAGCCAGGTGGGAGGCACGTGGG - Intergenic
1201077938 Y:10200628-10200650 GAGGCAGGAGGGAGCCCCCGAGG - Intergenic
1201334888 Y:12869961-12869983 GAGGCAGGAGGGAGAGAAGGAGG - Intergenic
1201731239 Y:17206034-17206056 GAGGGTGGTGGGAGGGATGGGGG - Intergenic