ID: 1161495577

View in Genome Browser
Species Human (GRCh38)
Location 19:4584234-4584256
Sequence CCGCTGGGCCTCAGTTTCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161495561_1161495577 22 Left 1161495561 19:4584189-4584211 CCAGCAGCGCCCTCCCAGCCGTG No data
Right 1161495577 19:4584234-4584256 CCGCTGGGCCTCAGTTTCCCCGG No data
1161495566_1161495577 9 Left 1161495566 19:4584202-4584224 CCCAGCCGTGGGATTCTGAGCAA No data
Right 1161495577 19:4584234-4584256 CCGCTGGGCCTCAGTTTCCCCGG No data
1161495564_1161495577 13 Left 1161495564 19:4584198-4584220 CCCTCCCAGCCGTGGGATTCTGA No data
Right 1161495577 19:4584234-4584256 CCGCTGGGCCTCAGTTTCCCCGG No data
1161495568_1161495577 4 Left 1161495568 19:4584207-4584229 CCGTGGGATTCTGAGCAAAGCCC No data
Right 1161495577 19:4584234-4584256 CCGCTGGGCCTCAGTTTCCCCGG No data
1161495565_1161495577 12 Left 1161495565 19:4584199-4584221 CCTCCCAGCCGTGGGATTCTGAG No data
Right 1161495577 19:4584234-4584256 CCGCTGGGCCTCAGTTTCCCCGG No data
1161495567_1161495577 8 Left 1161495567 19:4584203-4584225 CCAGCCGTGGGATTCTGAGCAAA No data
Right 1161495577 19:4584234-4584256 CCGCTGGGCCTCAGTTTCCCCGG No data
1161495560_1161495577 28 Left 1161495560 19:4584183-4584205 CCAGAGCCAGCAGCGCCCTCCCA No data
Right 1161495577 19:4584234-4584256 CCGCTGGGCCTCAGTTTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161495577 Original CRISPR CCGCTGGGCCTCAGTTTCCC CGG Intergenic