ID: 1161498369

View in Genome Browser
Species Human (GRCh38)
Location 19:4599268-4599290
Sequence GGCATGGAAGACCCCACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161498369_1161498373 15 Left 1161498369 19:4599268-4599290 CCCACAGTGGGGTCTTCCATGCC No data
Right 1161498373 19:4599306-4599328 ATCATCACAGCCTTCCCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161498369 Original CRISPR GGCATGGAAGACCCCACTGT GGG (reversed) Intergenic
No off target data available for this crispr