ID: 1161499358

View in Genome Browser
Species Human (GRCh38)
Location 19:4605023-4605045
Sequence TGTGACAGGGGGCAGCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161499347_1161499358 17 Left 1161499347 19:4604983-4605005 CCCTGTCTGGCCTATCCCACCTG No data
Right 1161499358 19:4605023-4605045 TGTGACAGGGGGCAGCACCCAGG No data
1161499349_1161499358 7 Left 1161499349 19:4604993-4605015 CCTATCCCACCTGCCAGTTTATA No data
Right 1161499358 19:4605023-4605045 TGTGACAGGGGGCAGCACCCAGG No data
1161499346_1161499358 18 Left 1161499346 19:4604982-4605004 CCCCTGTCTGGCCTATCCCACCT No data
Right 1161499358 19:4605023-4605045 TGTGACAGGGGGCAGCACCCAGG No data
1161499348_1161499358 16 Left 1161499348 19:4604984-4605006 CCTGTCTGGCCTATCCCACCTGC No data
Right 1161499358 19:4605023-4605045 TGTGACAGGGGGCAGCACCCAGG No data
1161499351_1161499358 1 Left 1161499351 19:4604999-4605021 CCACCTGCCAGTTTATAGATTAT No data
Right 1161499358 19:4605023-4605045 TGTGACAGGGGGCAGCACCCAGG No data
1161499350_1161499358 2 Left 1161499350 19:4604998-4605020 CCCACCTGCCAGTTTATAGATTA No data
Right 1161499358 19:4605023-4605045 TGTGACAGGGGGCAGCACCCAGG No data
1161499352_1161499358 -2 Left 1161499352 19:4605002-4605024 CCTGCCAGTTTATAGATTATGTG No data
Right 1161499358 19:4605023-4605045 TGTGACAGGGGGCAGCACCCAGG No data
1161499353_1161499358 -6 Left 1161499353 19:4605006-4605028 CCAGTTTATAGATTATGTGTGAC No data
Right 1161499358 19:4605023-4605045 TGTGACAGGGGGCAGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161499358 Original CRISPR TGTGACAGGGGGCAGCACCC AGG Intergenic
No off target data available for this crispr