ID: 1161504084

View in Genome Browser
Species Human (GRCh38)
Location 19:4634700-4634722
Sequence TGCTGCCTCCTCTGTAGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161504078_1161504084 2 Left 1161504078 19:4634675-4634697 CCCAGCTGGTATTTCCCCAGGCT No data
Right 1161504084 19:4634700-4634722 TGCTGCCTCCTCTGTAGTTCTGG No data
1161504074_1161504084 18 Left 1161504074 19:4634659-4634681 CCAGTCCTTAGCAGATCCCAGCT No data
Right 1161504084 19:4634700-4634722 TGCTGCCTCCTCTGTAGTTCTGG No data
1161504076_1161504084 13 Left 1161504076 19:4634664-4634686 CCTTAGCAGATCCCAGCTGGTAT No data
Right 1161504084 19:4634700-4634722 TGCTGCCTCCTCTGTAGTTCTGG No data
1161504079_1161504084 1 Left 1161504079 19:4634676-4634698 CCAGCTGGTATTTCCCCAGGCTG No data
Right 1161504084 19:4634700-4634722 TGCTGCCTCCTCTGTAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161504084 Original CRISPR TGCTGCCTCCTCTGTAGTTC TGG Intergenic
No off target data available for this crispr