ID: 1161507008

View in Genome Browser
Species Human (GRCh38)
Location 19:4649532-4649554
Sequence CCCCACCTAACGCCCTCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 90}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161507008_1161507014 -5 Left 1161507008 19:4649532-4649554 CCAGTTGAGGGCGTTAGGTGGGG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1161507014 19:4649550-4649572 TGGGGAAGGCACAGGGAGTTGGG 0: 1
1: 0
2: 5
3: 58
4: 493
1161507008_1161507015 -4 Left 1161507008 19:4649532-4649554 CCAGTTGAGGGCGTTAGGTGGGG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1161507015 19:4649551-4649573 GGGGAAGGCACAGGGAGTTGGGG 0: 1
1: 1
2: 7
3: 71
4: 611
1161507008_1161507016 3 Left 1161507008 19:4649532-4649554 CCAGTTGAGGGCGTTAGGTGGGG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1161507016 19:4649558-4649580 GCACAGGGAGTTGGGGTTCAAGG 0: 1
1: 0
2: 2
3: 24
4: 257
1161507008_1161507013 -6 Left 1161507008 19:4649532-4649554 CCAGTTGAGGGCGTTAGGTGGGG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1161507013 19:4649549-4649571 GTGGGGAAGGCACAGGGAGTTGG 0: 1
1: 0
2: 9
3: 66
4: 693
1161507008_1161507018 20 Left 1161507008 19:4649532-4649554 CCAGTTGAGGGCGTTAGGTGGGG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1161507018 19:4649575-4649597 TCAAGGGCGTTGAGAGCCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 109
1161507008_1161507017 4 Left 1161507008 19:4649532-4649554 CCAGTTGAGGGCGTTAGGTGGGG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1161507017 19:4649559-4649581 CACAGGGAGTTGGGGTTCAAGGG 0: 1
1: 0
2: 1
3: 24
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161507008 Original CRISPR CCCCACCTAACGCCCTCAAC TGG (reversed) Intronic
900812329 1:4816245-4816267 CACCACCTATGGCCCTCAAGTGG + Intergenic
904325496 1:29725118-29725140 CCCCACCCAGCACACTCAACAGG - Intergenic
907784689 1:57600066-57600088 CCCCACCTCACCCCATCACCAGG + Intronic
910447789 1:87316413-87316435 CCCCACTTAACACCCTCCAATGG + Intergenic
912573791 1:110644985-110645007 CCCCTCCTAACCTCCTCCACCGG - Intergenic
914347897 1:146815523-146815545 CCCCACCTAACGCACTCTCCTGG + Intergenic
918950633 1:191132066-191132088 CCCTACCTATCTCCCTCATCTGG - Intergenic
920613949 1:207470749-207470771 CCCCTCCTAACATCCTCAATGGG + Exonic
921341280 1:214136919-214136941 CCCCAGCTAATGTCCTCAGCAGG + Intergenic
924057479 1:240138190-240138212 CTCCACCTAACACCCTCCACCGG - Intronic
1068347590 10:55802087-55802109 CACCCCCTATCACCCTCAACAGG + Intergenic
1070819014 10:79343968-79343990 CCCCACCTCATGCCCACACCGGG + Intergenic
1075849524 10:125575596-125575618 TCCCACCTAACTCCTTCAATGGG + Intergenic
1084164398 11:67368324-67368346 CCCCACCTAACACCAAGAACGGG - Intronic
1085561631 11:77477215-77477237 CCTCACTTAACGCCATCAATGGG + Intergenic
1089496856 11:118912333-118912355 CCCCACCTAACCCCCTAAGAGGG - Intronic
1089687821 11:120168360-120168382 CCCCACGTCAGGCCCTCAAAAGG - Intronic
1095096279 12:38151078-38151100 CCCCACCCAACGACCTCTTCAGG - Intergenic
1103866184 12:124053826-124053848 CCCCACCTCTCGCGCTGAACAGG + Intronic
1103928265 12:124435626-124435648 CCCCAGCTAAGCCCCTCACCTGG + Intronic
1108742991 13:53357963-53357985 CCCCACCTAAATCCTTCCACTGG - Intergenic
1115861179 14:37687804-37687826 TCTCACCCAAGGCCCTCAACTGG - Intronic
1122236358 14:100332729-100332751 CCCCTCCTAAGACCCTAAACAGG + Intergenic
1124864745 15:33478094-33478116 CCCCCCCCAACCCCCTCAAGTGG - Intronic
1125019429 15:34969948-34969970 CCCCACCCAACACCATCCACCGG - Intergenic
1125733183 15:41905778-41905800 TCCCACCTCACCCTCTCAACTGG + Intronic
1129556561 15:76516369-76516391 CCCCACCCCACCCCCGCAACTGG + Intronic
1132719538 16:1309101-1309123 CCCCGCCTACCGCCCCGAACTGG + Exonic
1132909117 16:2299314-2299336 CCCCGCCTCACTCCCTCAATGGG - Intronic
1134314291 16:13104118-13104140 CCCCAGCTAATGCCCTCATACGG + Intronic
1134773538 16:16831944-16831966 CCCCACCCCACCCCCCCAACAGG + Intergenic
1135072636 16:19365411-19365433 CCCCACCTTCCACCCTCAATAGG - Intergenic
1135689294 16:24523376-24523398 CCTCACCTAACGTCATTAACAGG - Intergenic
1136721110 16:32320254-32320276 CCCCACCTAACACCCCCACAGGG + Intergenic
1136839492 16:33526540-33526562 CCCCACCTAACACCCCCACAGGG + Intergenic
1139986138 16:70900009-70900031 CCCCACCTAACGCACTCTCCTGG - Intronic
1140036466 16:71375156-71375178 CCCCACCTAAAGCCATCCAAAGG + Intronic
1140478734 16:75251452-75251474 CCCCACCTGGCGCCCTCACCAGG + Intronic
1141484066 16:84327102-84327124 CCTCACCTAACGTCATCAATAGG + Intronic
1203005322 16_KI270728v1_random:197516-197538 CCCCACCTAACACCCCCACAGGG - Intergenic
1203136872 16_KI270728v1_random:1733637-1733659 CCCCACCTAACACCCCCACAGGG - Intergenic
1203149658 16_KI270728v1_random:1826825-1826847 CCCCACCTAACACCCCCACAGGG + Intergenic
1143320348 17:6064454-6064476 CCCCACATCACCCCCTCTACTGG - Intronic
1144736793 17:17559985-17560007 CCCCACCTAAGGCCTCCACCAGG + Intronic
1144834971 17:18151948-18151970 CCCCACCTTCCCCCCTCACCTGG - Exonic
1145937010 17:28720211-28720233 CCCCCCCCAACTCCCTCTACCGG - Intronic
1145944095 17:28759957-28759979 CCCCACCCCAGGCCCTCAAAAGG - Intronic
1152379319 17:79934296-79934318 CCCCACCTCAGGCCACCAACTGG - Exonic
1161507008 19:4649532-4649554 CCCCACCTAACGCCCTCAACTGG - Intronic
1164073887 19:21795190-21795212 CCCCTCCTTACTCCCTCAAATGG - Intergenic
1167735736 19:51293630-51293652 CCCCACCCCACGCCGTCAAATGG - Intergenic
931857061 2:66313939-66313961 CCCCACCTCACCCCCTTGACAGG + Intergenic
934950546 2:98572490-98572512 TCCCTCCTAACTCCCTCATCTGG + Intronic
935699496 2:105799374-105799396 CCACATCTCACGCCCACAACAGG - Intronic
938209327 2:129453648-129453670 CCCAACCCAACTCCCTCAAAAGG - Intergenic
1169301518 20:4445683-4445705 CACCACCCAAAGCCCTCACCTGG - Intergenic
1172994669 20:39061296-39061318 CCCCAGTTAACTCCCTCAAGAGG + Intergenic
1174339044 20:49884622-49884644 CCCCTCCTCAGGCCCCCAACAGG - Intronic
1181908591 22:26219791-26219813 CCTCCCCTACCTCCCTCAACAGG - Intronic
949692053 3:6651864-6651886 CCCCACCCAACGTCCTCTCCAGG + Intergenic
954713130 3:52514651-52514673 ACCCACCTACCACCCTCACCTGG - Intronic
961060394 3:123823687-123823709 CCCCACTTAACACCCTCCAATGG + Intronic
969361871 4:6669602-6669624 TCCCACCTACGGCCATCAACTGG + Intergenic
970512484 4:16795033-16795055 CCGCTCCTAGCGCCCTCTACTGG - Intronic
970852700 4:20620217-20620239 CCCCACCTCACCCCCACAAAAGG - Exonic
972562154 4:40238333-40238355 CTCCACCTGACGCCCTCCACAGG - Intronic
977619760 4:99122945-99122967 CTCCCCCTACCCCCCTCAACAGG - Intergenic
978174232 4:105709310-105709332 CCCCAACCAACGCCTCCAACTGG - Intronic
985645745 5:1084012-1084034 CCCCACCCAGCTCCCCCAACGGG + Intronic
999679819 5:154046513-154046535 CCCCACCTACCGTACTCATCTGG - Intronic
1000523972 5:162332290-162332312 CCCCTCGTACCGCCCTCAACAGG - Intergenic
1001244686 5:170097128-170097150 CCCTGCCTCACGCCCTCAAAGGG - Intergenic
1011640280 6:89411706-89411728 CCCCACCCCAAACCCTCAACTGG + Intronic
1011934227 6:92754613-92754635 CCCCAGGTAACTCCCTCAGCTGG + Intergenic
1016033091 6:139357776-139357798 CCCCTCCTAAAGAACTCAACAGG - Intergenic
1016936578 6:149452566-149452588 CCCCACACAAGGCCCTGAACAGG + Intronic
1032185580 7:129722520-129722542 CCCCACGTAAAGACCTTAACTGG + Intronic
1032602262 7:133310315-133310337 CCTCACTTAATGCCCTCAATAGG + Intronic
1034504502 7:151476671-151476693 AGCCACCAAACGCCCTCCACTGG + Intronic
1035074582 7:156169323-156169345 CCCCACCCACCGCCCACCACTGG - Intergenic
1035459312 7:159029570-159029592 CCCCACGTAACCCCATCACCAGG + Exonic
1036643629 8:10599154-10599176 CCCGACCTGACACCCTCCACCGG - Intergenic
1036905251 8:12703279-12703301 CTCCACCTATGGCTCTCAACTGG - Intergenic
1037069510 8:14626303-14626325 CCTCCCCCAACCCCCTCAACAGG + Intronic
1039608324 8:38900882-38900904 CCCCACCCAGCGACCTCAGCTGG - Intergenic
1039951531 8:42176530-42176552 CCCCACCCAAGACCCTGAACCGG + Intronic
1041891095 8:62869671-62869693 CCCCACCTACCCCCCGCAAGGGG - Intronic
1044349548 8:91147857-91147879 CCCCACCTGGCCCCCCCAACAGG + Intronic
1048018860 8:130520150-130520172 CCCCACCCCAAGCCCTAAACAGG - Intergenic
1048200305 8:132368223-132368245 CCTCACTTAACGCCCTCAATAGG - Intronic
1049812184 8:144580567-144580589 CCCCGCCCACCGCCCTCACCTGG + Intronic
1056033672 9:82581829-82581851 CCTCACTTAACACCGTCAACAGG + Intergenic
1062106732 9:134758999-134759021 CCCCACCACACCTCCTCAACAGG - Intronic
1062268995 9:135700203-135700225 CCTCACCTCACACTCTCAACAGG + Intergenic
1192169168 X:68843812-68843834 CCCCACCTACCACCCTCACAGGG - Intergenic
1192250006 X:69404232-69404254 CCCCACCCAACACCCCCAACAGG + Intergenic
1195666104 X:107432750-107432772 CCCCAGCTCATGCCCTCACCAGG - Intergenic
1199471831 X:148204208-148204230 CCCCTCCTCACTCCCTCATCAGG - Intergenic
1199854575 X:151750030-151750052 AGCCACCTAACTGCCTCAACCGG - Intergenic