ID: 1161507018

View in Genome Browser
Species Human (GRCh38)
Location 19:4649575-4649597
Sequence TCAAGGGCGTTGAGAGCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161507008_1161507018 20 Left 1161507008 19:4649532-4649554 CCAGTTGAGGGCGTTAGGTGGGG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1161507018 19:4649575-4649597 TCAAGGGCGTTGAGAGCCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161507018 Original CRISPR TCAAGGGCGTTGAGAGCCAG TGG Intronic
905760138 1:40549324-40549346 TGAAGGGGGATGAGAGGCAGGGG - Intergenic
910468901 1:87529413-87529435 TCAAGCGCGTCCAGAGCCATTGG + Intergenic
910985284 1:92999078-92999100 AAAAGGGAGCTGAGAGCCAGAGG + Intergenic
912563873 1:110571262-110571284 CCAAGGACGTAGAGAGTCAGTGG + Intergenic
916378667 1:164184277-164184299 TGAAGGACTCTGAGAGCCAGTGG + Intergenic
922229590 1:223674137-223674159 TCAAGGGTGTTGAGTGCCTGTGG + Intergenic
923475149 1:234325054-234325076 CCAGGGGCTATGAGAGCCAGTGG + Intergenic
1065498033 10:26350006-26350028 TCATGGGCTTTGAGAGCCACAGG + Intergenic
1070459525 10:76650346-76650368 GAAAGGGAGTTGAGAGCCACAGG - Intergenic
1070587260 10:77775691-77775713 CCAAGGGAGGTGGGAGCCAGAGG - Intergenic
1070972849 10:80581800-80581822 TCAAGGCCTGTCAGAGCCAGAGG - Intronic
1071491803 10:86141230-86141252 CCAAGGGTGTTGACAGCCTGGGG - Intronic
1072265458 10:93722667-93722689 TCATGGGAGTTGATAGCCATGGG + Intergenic
1072691183 10:97573130-97573152 TCCTGGGCCTTGAGAGACAGTGG + Intronic
1074290670 10:112136102-112136124 TGAAAGTCGTTGAGAGCCCGAGG - Intergenic
1075985777 10:126783973-126783995 TCATGGGTGTTTAGAGCAAGGGG - Intergenic
1078438096 11:11342057-11342079 TCAAGGGCTGTGGGGGCCAGAGG - Intronic
1079801029 11:24869088-24869110 TCAGGAGTTTTGAGAGCCAGTGG + Intronic
1080141245 11:28922875-28922897 TCAAGAGGCTTGAGAGCCACAGG + Intergenic
1080248041 11:30201591-30201613 TCAAAGGGCTTGAGAACCAGGGG - Intergenic
1081552064 11:44122730-44122752 ACAAGGTAGGTGAGAGCCAGAGG - Intronic
1082906089 11:58309965-58309987 TCAAGGGAGTTGGGTGACAGGGG + Intergenic
1085426838 11:76412288-76412310 TCAAGTGTTTTGGGAGCCAGAGG + Intronic
1087349966 11:97019411-97019433 TGAAGTGGGTTCAGAGCCAGTGG + Intergenic
1089739336 11:120571634-120571656 TGAGGGGTGGTGAGAGCCAGGGG - Intronic
1091960134 12:4687004-4687026 TCAATGGCCTTGAGTTCCAGTGG - Exonic
1099758988 12:86893730-86893752 ACAATGGGGTTGAGAGCCACAGG - Intergenic
1102457930 12:113082337-113082359 CCACGGGTCTTGAGAGCCAGAGG - Intronic
1103197688 12:119059406-119059428 TCAAGGACTTGGGGAGCCAGAGG + Intronic
1103659986 12:122506492-122506514 TCCAGGGCTTTGAGAGGCCGAGG + Intronic
1104618291 12:130289551-130289573 TAAAGGCCGTGGAGAGACAGCGG - Intergenic
1108086022 13:46794699-46794721 TCTAGGTTGTTAAGAGCCAGTGG - Intronic
1108844196 13:54658833-54658855 CCAAGGGCGTGGAGTGGCAGGGG + Intergenic
1110122903 13:71905326-71905348 TCCAGTGCTTTGAGAGGCAGAGG - Intergenic
1112394360 13:99014881-99014903 TGAAGGGTCTTGAGAGCGAGAGG - Intronic
1120883049 14:89429384-89429406 GCCAGTGCGTTGAGAGGCAGCGG - Intronic
1122057158 14:99108227-99108249 TCCAGGACTTTGAGAGGCAGAGG - Intergenic
1137394882 16:48109912-48109934 TCAAGGGCGGTGAAAGCTGGAGG - Intronic
1139329313 16:66175256-66175278 TCAAGGCTGTTGGGAGTCAGGGG + Intergenic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1142514219 17:416431-416453 TCCATGGCGGTGAGAGGCAGGGG + Intronic
1143334662 17:6163221-6163243 GCAAGGGTGCAGAGAGCCAGTGG + Intergenic
1150310939 17:64129531-64129553 GAAAGGGCGTTGGGATCCAGGGG - Intronic
1151226383 17:72651255-72651277 GCAACAGCGTTGAGAGCCACTGG + Intronic
1151227071 17:72655516-72655538 GCGAGGGCGTTGAGAGCCACTGG + Intronic
1151296352 17:73189275-73189297 TCAAGGACTTCTAGAGCCAGGGG + Intergenic
1152118143 17:78401365-78401387 TCAAGGGAGCTGGGAGCCACAGG - Intronic
1156673883 18:39504399-39504421 TGAAGGTTGTTGAGAGGCAGAGG + Intergenic
1157330779 18:46702402-46702424 CCAAGGGCCATGAGAGCCACGGG - Intronic
1157567518 18:48689700-48689722 TCAAGGTTGTTGTGAGTCAGAGG + Intronic
1158772441 18:60535844-60535866 TCAGGGGTGTTGATAGCCACAGG + Intergenic
1161507018 19:4649575-4649597 TCAAGGGCGTTGAGAGCCAGTGG + Intronic
1162379109 19:10321426-10321448 ACAAGGGCGCTGGGACCCAGAGG + Intronic
1163176672 19:15569126-15569148 CCAAGGGCGTCCAGAGCCACGGG - Intergenic
1163524867 19:17814670-17814692 TCCAGGGCTTTGGGAGGCAGAGG + Intergenic
1163697337 19:18770473-18770495 TTAGGGGCTTAGAGAGCCAGGGG + Intronic
1163849324 19:19654484-19654506 CCTAGGGCTGTGAGAGCCAGTGG + Intronic
1166377007 19:42333409-42333431 TCAAGGGCTGTGACAGCCAGAGG - Intronic
1167838330 19:52093881-52093903 TCCAGTGCGTTGAGAGGCTGAGG + Exonic
925160541 2:1680771-1680793 TGATGGGCGTTGAGTGACAGTGG - Intronic
925885701 2:8392359-8392381 TCAAGGGGGTGTTGAGCCAGAGG + Intergenic
929042865 2:37762536-37762558 TCAAGGGAGGTAAGATCCAGGGG + Intergenic
935008675 2:99109252-99109274 TCAAAGGGGTTGAGAGACAGAGG - Intronic
935236168 2:101139853-101139875 TCAATGGTGGTGAGTGCCAGGGG - Intronic
936497750 2:113037162-113037184 TCGTGGACGTTGAGAGCCATAGG - Intronic
938481271 2:131663656-131663678 TCCAGGACGTTGAGAGGCTGAGG - Intergenic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
1169983449 20:11413387-11413409 TCTAGGGCTTTCAGAGGCAGGGG - Intergenic
1181511567 22:23391545-23391567 TCACGGGCAGTGAGAGGCAGTGG + Intergenic
1183136854 22:35897345-35897367 TCAATGGCCTTGAGTTCCAGTGG + Intronic
1203295053 22_KI270736v1_random:34032-34054 TCAAGGGAGATAAGATCCAGGGG + Intergenic
952944469 3:38468371-38468393 TCAAGGGGGTTGAGAACTAGGGG + Intronic
957129121 3:76200444-76200466 TAAAGGCCATTGAGAACCAGTGG - Intronic
958869703 3:99543390-99543412 ACAAGGACATTGAGTGCCAGAGG - Intergenic
961530553 3:127537492-127537514 TGCAGGGCATTGAGGGCCAGAGG - Intergenic
962251891 3:133840717-133840739 TCAAGGGCGCACAGGGCCAGAGG - Intronic
968065104 3:195754139-195754161 TCAAGGGTGTAGACAGCCAAAGG - Intronic
969364797 4:6688085-6688107 TCAAGGACATTGAGAAGCAGCGG - Intergenic
970380798 4:15505547-15505569 TCAGTGGAGTTGACAGCCAGTGG + Intronic
972817210 4:42657221-42657243 TGAGGGGCGGGGAGAGCCAGGGG + Intergenic
979675301 4:123402786-123402808 TTGAGGGTATTGAGAGCCAGTGG + Exonic
983562825 4:169118065-169118087 TCCAGGGCCTTGAAAGTCAGTGG - Intronic
986168616 5:5297188-5297210 TAAAGGGCATCCAGAGCCAGTGG - Intronic
991927493 5:71719462-71719484 TCAAGGGGGTCGAGAGCGAGGGG - Intronic
995430794 5:112074144-112074166 TCAAAGGCCTGGAGAGACAGAGG + Intergenic
997477535 5:134153609-134153631 TAAAGGGTGCTGAGAGCAAGAGG + Exonic
1002493923 5:179599222-179599244 TCATGGGCCCTGGGAGCCAGGGG + Intronic
1003583084 6:7360193-7360215 TCAAGGGCCTTGAGATTCAGGGG - Intronic
1005522490 6:26613244-26613266 GCAGGGTCGTAGAGAGCCAGCGG + Intergenic
1005603800 6:27454880-27454902 TCGAGGGTGTTGACAACCAGGGG + Intronic
1006791497 6:36704134-36704156 CCAAGGGTGATGGGAGCCAGGGG + Intronic
1007500506 6:42293356-42293378 TCAAGGGAGATGAGAACCAAAGG + Intronic
1010151865 6:72742038-72742060 TGAAGGCAGTTGACAGCCAGTGG - Intronic
1012950761 6:105515416-105515438 TCAGGCGCTGTGAGAGCCAGAGG - Intergenic
1016844401 6:148556707-148556729 CCAAGGGTGCTGAGAGGCAGTGG - Intergenic
1018725827 6:166612800-166612822 TCAAGGGCATGGAGAGAGAGAGG - Intronic
1018940141 6:168304117-168304139 TCAAGTGCGTTGGAAGACAGAGG - Intronic
1023254251 7:38297393-38297415 TCACCAGCGTTGAGAGGCAGTGG + Intergenic
1026853270 7:73737816-73737838 TCAAAGGTGTGGAGAGCCTGGGG + Intronic
1026987665 7:74564963-74564985 TCAAGGGAGCTGTGGGCCAGGGG + Intronic
1029319222 7:99742866-99742888 TCAAGGGCACTGAGAGGCTGGGG + Intergenic
1030971642 7:116064542-116064564 TCAAGGGGGTGGAGGGCAAGGGG + Intronic
1031145408 7:117992183-117992205 TTAAAGGCTTTGAGAACCAGTGG - Intergenic
1035777713 8:2202336-2202358 TCAAAGGAGTGCAGAGCCAGTGG + Intergenic
1037571710 8:20163558-20163580 TCAAAGGTGTTGGGAGCCAAAGG - Intronic
1038459534 8:27704193-27704215 TCCAGTGCTTTGAGAGGCAGAGG + Intergenic
1045695184 8:104801187-104801209 TTAAGGGCAATGAGAGCCACTGG + Intronic
1048035326 8:130672511-130672533 TCAAGGGAGCTGAGAGGCCGAGG - Intergenic
1049259119 8:141629404-141629426 CCAAGGGCCCCGAGAGCCAGCGG - Intergenic
1051227012 9:14910002-14910024 TAAAGGGCTTTGAGAGGAAGGGG + Exonic
1051400028 9:16671043-16671065 TCAAGGGAAATGAGAGCCAATGG + Intronic
1052092333 9:24344175-24344197 TCAAGCACTTTGAGAGGCAGAGG + Intergenic
1185768688 X:2748128-2748150 CCCAGGACTTTGAGAGCCAGAGG - Intergenic
1188097524 X:26042836-26042858 TCAAGGGAGTTGGGTGACAGGGG - Intergenic
1192314473 X:70041323-70041345 ACTGGGGCCTTGAGAGCCAGTGG - Exonic
1192648850 X:72930221-72930243 TCAAGGTGGTTGATACCCAGAGG + Intronic
1192855093 X:75000511-75000533 TCAGGGGGGCTCAGAGCCAGTGG - Intergenic
1200880803 Y:8209689-8209711 TCAAGGGAGTTGGGTGACAGGGG + Intergenic