ID: 1161507538

View in Genome Browser
Species Human (GRCh38)
Location 19:4652025-4652047
Sequence GCATCTTCTGGGCCTCCTTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 1, 2: 2, 3: 26, 4: 217}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161507538_1161507551 28 Left 1161507538 19:4652025-4652047 CCGCAAGGAGGCCCAGAAGATGC 0: 1
1: 1
2: 2
3: 26
4: 217
Right 1161507551 19:4652076-4652098 GCTGGGACTGCTGCTGCGTGGGG 0: 1
1: 0
2: 5
3: 39
4: 356
1161507538_1161507545 10 Left 1161507538 19:4652025-4652047 CCGCAAGGAGGCCCAGAAGATGC 0: 1
1: 1
2: 2
3: 26
4: 217
Right 1161507545 19:4652058-4652080 GGTCAAGGTGGCCCTGAAGCTGG 0: 1
1: 0
2: 4
3: 26
4: 238
1161507538_1161507546 11 Left 1161507538 19:4652025-4652047 CCGCAAGGAGGCCCAGAAGATGC 0: 1
1: 1
2: 2
3: 26
4: 217
Right 1161507546 19:4652059-4652081 GTCAAGGTGGCCCTGAAGCTGGG 0: 1
1: 0
2: 3
3: 24
4: 202
1161507538_1161507542 -5 Left 1161507538 19:4652025-4652047 CCGCAAGGAGGCCCAGAAGATGC 0: 1
1: 1
2: 2
3: 26
4: 217
Right 1161507542 19:4652043-4652065 GATGCTCAAGAACCTGGTCAAGG 0: 1
1: 0
2: 0
3: 11
4: 126
1161507538_1161507550 27 Left 1161507538 19:4652025-4652047 CCGCAAGGAGGCCCAGAAGATGC 0: 1
1: 1
2: 2
3: 26
4: 217
Right 1161507550 19:4652075-4652097 AGCTGGGACTGCTGCTGCGTGGG 0: 1
1: 0
2: 0
3: 26
4: 220
1161507538_1161507543 -2 Left 1161507538 19:4652025-4652047 CCGCAAGGAGGCCCAGAAGATGC 0: 1
1: 1
2: 2
3: 26
4: 217
Right 1161507543 19:4652046-4652068 GCTCAAGAACCTGGTCAAGGTGG 0: 1
1: 0
2: 1
3: 14
4: 113
1161507538_1161507549 26 Left 1161507538 19:4652025-4652047 CCGCAAGGAGGCCCAGAAGATGC 0: 1
1: 1
2: 2
3: 26
4: 217
Right 1161507549 19:4652074-4652096 AAGCTGGGACTGCTGCTGCGTGG 0: 1
1: 0
2: 1
3: 19
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161507538 Original CRISPR GCATCTTCTGGGCCTCCTTG CGG (reversed) Exonic
901512201 1:9723019-9723041 GCATCTTCTGTGGCTTTTTGGGG + Intronic
903475252 1:23615136-23615158 GCATCTTCTGGGTCTCTCTGAGG + Intronic
904086709 1:27914459-27914481 GCACCTTCTCGGCCTCTTTGCGG - Exonic
905412204 1:37778458-37778480 TGATCCTCTGGGCTTCCTTGTGG - Intergenic
905885229 1:41488197-41488219 GAGTCTCCTGGGCCTCCTTCTGG - Intergenic
906964794 1:50445697-50445719 CCACCTTTTGGGACTCCTTGGGG + Intronic
908825185 1:68126225-68126247 CCTACTCCTGGGCCTCCTTGCGG + Intronic
910432531 1:87173196-87173218 CAATCTTCTGGGCCTCTTTCTGG + Intergenic
911182729 1:94875506-94875528 GCCCCTTCTGAGCCTCCTGGAGG + Intronic
911467623 1:98275051-98275073 GTATTTTCTGGGCATCCTTATGG - Intergenic
913873936 1:124014918-124014940 GGATATTCAGGACCTCCTTGAGG + Intergenic
918081355 1:181210101-181210123 GCATCATCAGGGCCTCTTGGAGG + Intergenic
919784505 1:201250763-201250785 GCATCTCCTGGGTCTCCCAGAGG - Intergenic
920029727 1:203029239-203029261 GCAACCTCGGGGCCTCCTTGAGG + Intronic
920556367 1:206907657-206907679 CCATCTCCTGGGCCCCCTGGCGG + Intronic
922483327 1:225954798-225954820 GCAGCTTCTGGGCTTCCCTAGGG + Intergenic
922764175 1:228149039-228149061 CCATCTTGTGGCCCTCCTTGGGG - Intergenic
923684253 1:236142876-236142898 GCCTCTTCTGGGCCTCCCTGCGG + Exonic
924653041 1:245948169-245948191 GCATCTTCTCAGTCACCTTGAGG - Intronic
924849233 1:247808254-247808276 GCATCTTCAGGGACTCTTTAAGG + Intergenic
1063022979 10:2147696-2147718 GCATCTTCTGGGCCTGACTCTGG + Intergenic
1066039976 10:31539362-31539384 GCATAGTCTGGGCACCCTTGTGG + Intergenic
1067082381 10:43219000-43219022 GCTTCTTCTGGGCCTGCTCAGGG + Intronic
1067824892 10:49563774-49563796 GTGTCTTCTGGGCCTCCTGCTGG + Intergenic
1068705539 10:60071429-60071451 TCATCTTCTGGACTACCTTGGGG + Exonic
1069629113 10:69887204-69887226 GCATCCTCTGGGTCTACTTCTGG - Intronic
1070493103 10:76995760-76995782 GCCTCTTCTGGGCTTACATGAGG + Intronic
1072582336 10:96750326-96750348 CCATCTCCTGGGCCGCCTGGCGG + Intergenic
1072766738 10:98100734-98100756 AAATCTTCTGGGCCTGCCTGGGG + Intergenic
1075921952 10:126220923-126220945 GAAGCCTCTGGGCCTCCATGTGG - Intronic
1076304993 10:129459852-129459874 GCATTTACTGGGCCTCATAGGGG - Intergenic
1076875058 10:133211705-133211727 GCACCTGCTGGGCCTCCTGGAGG + Exonic
1077235487 11:1480174-1480196 GCACCTTCTGGGCCCCACTGGGG + Intronic
1078026953 11:7705074-7705096 ACATCTTCTGTCCCTCCTGGAGG + Intronic
1080964679 11:37201077-37201099 GTATCTTCTGGGCATACGTGAGG - Intergenic
1081984082 11:47289073-47289095 GCATCTTCTGTGCCTGCCCGAGG + Intronic
1082902281 11:58267795-58267817 GCATATTCTGTCCTTCCTTGGGG - Exonic
1083713797 11:64564398-64564420 TCAGGTTCTTGGCCTCCTTGTGG - Exonic
1083808464 11:65088712-65088734 GCATCTGCTGGGCTGCCATGGGG - Exonic
1084007511 11:66331175-66331197 GCCTGCTCTGGGCTTCCTTGGGG + Intronic
1084497045 11:69511187-69511209 GCATCTTCTGGGGGTGCTTCTGG + Intergenic
1084765884 11:71308097-71308119 GCATCCTCTGGGTCCCCTTTAGG - Intergenic
1085351973 11:75803414-75803436 CCATCTTCAGTGCCCCCTTGTGG - Intergenic
1087886370 11:103487662-103487684 GCATATTGTGGGACTTCTTGGGG + Intergenic
1090182833 11:124716112-124716134 GTATCCTCTGGGCCTTCCTGGGG - Intergenic
1090858715 11:130634236-130634258 GAATCCTCTGGGCATCCCTGTGG + Intergenic
1091268989 11:134292563-134292585 CCATCTTCTGGTTCTCCCTGTGG - Intronic
1091278205 11:134366596-134366618 GAATGATCTTGGCCTCCTTGGGG + Intronic
1091758539 12:3072088-3072110 CCATCTCCTGGGCCGCCTGGCGG - Intergenic
1092879288 12:12875537-12875559 CCATCTCCTGGGCCACCTGGCGG + Intergenic
1093777998 12:23099798-23099820 GGATATCCTGGGGCTCCTTGAGG + Intergenic
1094528818 12:31252539-31252561 CCATCTCCTGGGCCGCCTGGCGG - Intergenic
1095633018 12:44400025-44400047 TCATCTCCTGGGCCTTCCTGTGG - Intergenic
1096229348 12:49888720-49888742 GGGTCTTCTGGGGCTCCTGGGGG - Intronic
1096566771 12:52488473-52488495 GCTTGTTCTTGGCATCCTTGAGG + Exonic
1096593267 12:52676420-52676442 GCTTGTTCTTGGCATCCTTGAGG + Exonic
1097272565 12:57786177-57786199 CCTCCTTCTGGGCCTCCTTGTGG - Exonic
1100401157 12:94231339-94231361 GCATCCTCTGTGCCTACTTAGGG - Intronic
1100764153 12:97845278-97845300 CCATCTTCTGGGGCTCCTTGGGG + Intergenic
1101217667 12:102600917-102600939 TAATCTTCTGGGCCTCTTTGGGG + Intergenic
1102796181 12:115690757-115690779 GGATATTCTTGGCCTACTTGTGG - Intergenic
1103007667 12:117435147-117435169 GCAGTTTCTGGGCATCCGTGGGG - Intronic
1103394557 12:120597686-120597708 ACGTCTCCTGGGCCTCCTTCAGG + Intergenic
1104976167 12:132552888-132552910 GCAGTTGCTGGGCCTCCGTGGGG + Intronic
1105203723 13:18201778-18201800 ACATCTTCTGGGGCTTCCTGTGG - Intergenic
1106701638 13:32235225-32235247 CTATCTTGAGGGCCTCCTTGTGG - Intronic
1108828156 13:54441255-54441277 CCATCTCCTGGGCCGCCTGGCGG - Intergenic
1108934305 13:55866933-55866955 GAATCACCTGGGCCTCCTGGAGG + Intergenic
1112658833 13:101483358-101483380 ACATCTTCTTGTCCTTCTTGTGG - Intronic
1116620820 14:47201044-47201066 CCATCTCCTGGGCCGCCTGGCGG - Intronic
1117441700 14:55766215-55766237 CCATCTCCTGGGCCGCCTGGCGG + Intergenic
1117549979 14:56825347-56825369 GTCTCTGCTGGGCCTCCTTTAGG + Intergenic
1119257182 14:73208692-73208714 GCATTTTCTGGGCCTGCTCATGG - Intronic
1119419521 14:74500286-74500308 GGATCTTCTGCCACTCCTTGGGG + Exonic
1119736447 14:76985765-76985787 GCATCTTCTGGGACTATATGTGG + Intergenic
1121004821 14:90483504-90483526 GCACCTGCTGGGCCTCCTGTTGG + Intergenic
1121029918 14:90649611-90649633 GCATTTTGTGAGCATCCTTGTGG - Intronic
1123006960 14:105328370-105328392 GCCTCCTCTGGGCCTTCCTGGGG + Intronic
1123702749 15:22927989-22928011 CCGTCTTCTGGGCCTCCTGGCGG + Exonic
1126108681 15:45163146-45163168 GCAGCTGCTGGGTCTCCCTGAGG + Intronic
1126479914 15:49106808-49106830 GCATCCTCTTGGCATCCTTTGGG - Intronic
1128977651 15:72165277-72165299 GAGGCTTCTGGGCCTCCTAGGGG - Intronic
1131413431 15:92230377-92230399 AGAACTTCTGGGCCTTCTTGGGG + Intergenic
1133226151 16:4341406-4341428 GAATCTGCTGTGCCTCCTGGAGG + Exonic
1134240867 16:12505388-12505410 GAATTTTCTTGGCATCCTTGTGG + Intronic
1135833187 16:25796958-25796980 GTATTTTCTGGGCCTCCTTCGGG + Intronic
1137250369 16:46736769-46736791 GCATCTTCTGCGCCTGCCTAGGG - Intronic
1138530498 16:57631823-57631845 GCCCCATCTGGGGCTCCTTGAGG + Intronic
1139533448 16:67556226-67556248 GAATCTTCCTGCCCTCCTTGGGG - Intergenic
1140723136 16:77788787-77788809 GCATCTCCTGGGCGTCCCCGAGG - Exonic
1141386058 16:83623433-83623455 CCCTCTTCTGGGGCTCCTTGAGG + Intronic
1141429776 16:83965584-83965606 GCATCATCTGGTGCACCTTGTGG - Exonic
1141839954 16:86567944-86567966 CCTTCTTCTCGGCCTCCTTGGGG - Exonic
1142522826 17:517131-517153 GCATCTACAGGGCTTCCTGGGGG + Exonic
1143646235 17:8232058-8232080 GCTTCATGAGGGCCTCCTTGTGG + Exonic
1144873357 17:18383494-18383516 CCATCTTCAGGGCCTCCTGGTGG - Exonic
1144950641 17:18991827-18991849 GCCTCTGCTGGGCGGCCTTGAGG + Intronic
1145445715 17:23170786-23170808 GCATCCTCAGGAACTCCTTGGGG + Intergenic
1145915923 17:28574005-28574027 CCATCTTCAGGTCCTTCTTGTGG - Intronic
1145935965 17:28715065-28715087 TCATCTCCTGGGCCACCTGGAGG + Exonic
1146761512 17:35482868-35482890 GCCTCTTCTGGGGCTGCATGTGG + Intronic
1150069290 17:62138346-62138368 GCATCTCCCGGGCCACCTTCTGG + Intergenic
1151351535 17:73534852-73534874 GCATCTTCTAGGCCTCCTTGTGG + Intronic
1151397464 17:73833327-73833349 GCATCTTCTGAGCCACCCTCAGG + Intergenic
1151747884 17:76021539-76021561 CCATCTTCAGGGCCTCCTGGTGG + Exonic
1153571590 18:6478445-6478467 GCATCTTCTTTGGCTCTTTGTGG - Intergenic
1154306120 18:13232204-13232226 GCGTCTTCTGGGCGCTCTTGTGG + Intronic
1154357523 18:13633265-13633287 GCTTTTTCTGGGCCTGCCTGTGG - Intronic
1157962017 18:52165164-52165186 GCAGCTTCTGCTCCACCTTGGGG - Intergenic
1158213222 18:55073081-55073103 CCAACTGCTGGGTCTCCTTGTGG + Intergenic
1160135086 18:76264857-76264879 GTTTCTCCTGGGCCTCCATGGGG - Intergenic
1160726901 19:621381-621403 GCATCTCCCGGGCCACCTTCTGG + Exonic
1161507538 19:4652025-4652047 GCATCTTCTGGGCCTCCTTGCGG - Exonic
1162105183 19:8365995-8366017 GCTGCTGCTGGGCCACCTTGTGG - Exonic
1162752058 19:12834952-12834974 GGCCCTTCTGAGCCTCCTTGGGG + Intronic
1163534436 19:17869071-17869093 GTATCTTCTGGGCCTCCGGAAGG - Intergenic
1163567853 19:18062234-18062256 TCATCTTCTTCGCCTCCCTGGGG - Exonic
1164751378 19:30657537-30657559 TGCTCTTCTGGCCCTCCTTGGGG + Intronic
1165279234 19:34782549-34782571 GCAGTTGCTGGGGCTCCTTGGGG + Intergenic
1165829680 19:38724234-38724256 CGATCCTCTGGGCCTCCTTGTGG - Exonic
1167420081 19:49397644-49397666 TCAGCTTCTGGGCATCCTGGAGG - Exonic
1167437777 19:49489873-49489895 CCATCTCCTGGGCCGCCTGGCGG + Exonic
1168728133 19:58602524-58602546 CCATCTTCTGTGCCACCTTAGGG - Intergenic
928418195 2:31114294-31114316 CCAGCTTCTGGTCCTCTTTGTGG - Intronic
929668525 2:43852077-43852099 GTGTTTTCTGGGCCTCCATGTGG + Intronic
931149099 2:59553001-59553023 TCCTCTTCTTGGCCTGCTTGAGG + Intergenic
932514114 2:72327167-72327189 GTAACTTCTGGACCTCTTTGAGG - Intronic
933695301 2:85213072-85213094 GCGTTTTCTGGGCCTCCCTTGGG - Intronic
937308479 2:120886783-120886805 GCAACGTCTGGGGTTCCTTGGGG - Intronic
938479422 2:131647091-131647113 GCAGATCCTGGGCCTCCCTGGGG + Intergenic
939177136 2:138761493-138761515 GCATCTGCTGTGCCTCCTGTTGG + Intronic
942872840 2:180756161-180756183 GCATTTGTTTGGCCTCCTTGTGG + Intergenic
945194218 2:207223343-207223365 GCATGGTCTGGTCCTTCTTGGGG - Intergenic
945620907 2:212135882-212135904 CCATCATCTGGCTCTCCTTGAGG + Intronic
947728567 2:232415949-232415971 GCATCTTCTGTGCCACCTCTGGG + Intergenic
948093349 2:235314280-235314302 GCATGGTCTGAGTCTCCTTGGGG - Intergenic
1171287845 20:23956830-23956852 GCATCTTCTGGGCCAGGTGGTGG - Intergenic
1173166412 20:40689616-40689638 GCTCATTCTGAGCCTCCTTGGGG - Intergenic
1173620588 20:44432891-44432913 GAATCTTCTGGTTCTACTTGGGG + Intergenic
1174950751 20:55038893-55038915 GTATCTTCTGGGGCTGCTTGTGG - Intergenic
1175307489 20:57986987-57987009 TCATCTGCTGGCCCTCCTGGTGG - Intergenic
1175542998 20:59759920-59759942 CCATGTTCTGGGCCCCCATGAGG - Intronic
1176714245 21:10336298-10336320 ACATCTTCTGGGGCTTCCTGTGG + Intergenic
1180160331 21:45996285-45996307 TGAGCTTCTGGACCTCCTTGAGG + Intronic
1180761306 22:18210202-18210224 ACATCTTCTGGGCTTCCTGTGGG + Intergenic
1180774361 22:18414417-18414439 ACATCTTCTGGGCTTCCTGTGGG - Intergenic
1180784535 22:18539464-18539486 GCTCCTCCTTGGCCTCCTTGGGG - Intergenic
1180807514 22:18725234-18725256 ACATCTTCTGGGCTTCCTGTGGG - Intergenic
1181070474 22:20333425-20333447 ACATCTTCTGGGGCTTCCTGTGG - Intergenic
1181128112 22:20713517-20713539 GCTCCTCCTTGGCCTCCTTGGGG - Intronic
1181193460 22:21161367-21161389 ACATCTTCTGGGCTTCCTGTGGG - Intergenic
1181215983 22:21331232-21331254 ACATCTTCTGGGCTTCCTGTGGG + Intergenic
1181241438 22:21478821-21478843 GCTCCTCCTTGGCCTCCTTGGGG - Intergenic
1181521229 22:23449858-23449880 GCATCTGCGAGGCCTCCTTTGGG + Intergenic
1182455509 22:30447899-30447921 GCCTCTTCTGGGCCTATTTAAGG + Intergenic
1183200104 22:36380120-36380142 GCAGCCTCCGGGCCTCCTGGGGG - Intronic
1183704557 22:39468906-39468928 GAAACTTCTGTGCCTCCTTGAGG + Intronic
1184091801 22:42296732-42296754 GCATCAGCAGGGCCCCCTTGTGG - Intronic
1184171694 22:42764005-42764027 GCATTCTCAGGGCCTCTTTGTGG - Intergenic
1184986579 22:48140142-48140164 TCATCCTCTGGGCATCTTTGCGG + Intergenic
1185044580 22:48522694-48522716 ACATCATCTGGGCCTGCCTGGGG + Intronic
951309280 3:21104632-21104654 CCATCTTTTGGACTTCCTTGAGG + Intergenic
951683946 3:25324307-25324329 ACATCTGCTTGCCCTCCTTGAGG - Intronic
951771593 3:26263646-26263668 GCATCTTCTGGTCCTCAACGGGG + Intergenic
952817120 3:37455208-37455230 GGATCTTCTAGTCCTGCTTGAGG + Intronic
953183084 3:40614701-40614723 GCTCCATCTGGGACTCCTTGTGG + Intergenic
953892531 3:46763753-46763775 TCAACTTCTGGGCTTCCTAGTGG - Intronic
957420333 3:79959988-79960010 ACATCTTCTGAGCATCCTTTGGG - Intergenic
963110851 3:141686747-141686769 GCAAATTCTGGGTCTCCTGGTGG - Intergenic
964184831 3:153930214-153930236 GCACCTTCTGAGCCACCTGGTGG + Intergenic
966342915 3:178945518-178945540 GCATCTGCTTGGCTTCCTGGGGG + Intergenic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968934978 4:3605107-3605129 GCAGGTTCTGGGCCTCCTTAGGG + Intergenic
968954386 4:3710821-3710843 GAAGGTTCTGGTCCTCCTTGCGG + Intergenic
969469534 4:7379318-7379340 GCATCTGCAGGGCTGCCTTGGGG + Intronic
972326884 4:38025310-38025332 GCATCACCTGGGCCTCTCTGAGG + Intronic
974301361 4:60071902-60071924 GCATGTTCTTGGCACCCTTGTGG - Intergenic
978443475 4:108758750-108758772 GCATCTCTTGGGGCTCCTTCTGG + Intronic
979099579 4:116598655-116598677 CGATCCTCTGGGCCTCCTTGTGG - Intergenic
980378509 4:131978266-131978288 GCAACTTCAGGGCCTGCCTGGGG - Intergenic
982854691 4:160365521-160365543 GGCTCTTCTGGGCCTCTTTAGGG - Intergenic
985951941 5:3228970-3228992 GAATCTTCTGGAGCTTCTTGAGG + Intergenic
986047125 5:4049993-4050015 TCATTTTCTGGGCATCCTAGTGG + Intergenic
986863010 5:11950251-11950273 ATATCTTCTGGTCCTACTTGGGG - Intergenic
987492391 5:18597372-18597394 GCATCTTCTGAGCCTCCCTTAGG - Intergenic
987854556 5:23402949-23402971 GCATCTTCTGGTCTTCTTGGAGG - Intergenic
993118579 5:83746929-83746951 CCATCTCCTGGGCCGCCTGGCGG - Intergenic
993872998 5:93273756-93273778 ACATAGCCTGGGCCTCCTTGAGG + Intergenic
996566389 5:124883500-124883522 ACATCTTCTGGTCCTGTTTGGGG - Intergenic
998426178 5:142030667-142030689 GGCTCTTCGGGGCCTCCCTGAGG - Intergenic
999197595 5:149793094-149793116 CCATCATCTGGGCCTCCCTGTGG + Intronic
999521805 5:152358517-152358539 GGCTCTTCTGGGCCTCTTTAGGG + Intergenic
999859917 5:155633851-155633873 GCCTCTTCTGGGCCTGCCCGTGG + Intergenic
1000637343 5:163659400-163659422 TTATCTTCTGGTCCTACTTGAGG + Intergenic
1003109026 6:3238206-3238228 GGGGCTTCCGGGCCTCCTTGCGG + Intronic
1004315254 6:14581240-14581262 GCATCTTCCGTGCCCCCTTCAGG - Intergenic
1005351922 6:24944622-24944644 ACATCTTCTGGGCTTCATTAGGG - Intronic
1007298317 6:40845789-40845811 GTGTCTTCTGCGCCTCCTTGTGG + Intergenic
1008675449 6:53813301-53813323 GCAACTCCTGGGCTTCCTTAAGG - Intronic
1009203007 6:60768542-60768564 GCCTCTTCTGGGCTTCTTTAGGG + Intergenic
1009837362 6:69019709-69019731 GCATCTTCTGAGCCTATTGGAGG + Intronic
1010343233 6:74781667-74781689 GCATCTTCTGGACCTTCCTTGGG + Intergenic
1013166981 6:107603417-107603439 GCATCTCATGGGCCTCCATGGGG + Intronic
1013480549 6:110549422-110549444 GCCTCATCTGGGCCACCTGGTGG - Intergenic
1014717787 6:124886372-124886394 GAACCTTCTGGACCTCCCTGAGG - Intergenic
1017801572 6:157900921-157900943 GGCTCTTCTGGGCCTCTTTAGGG - Intronic
1017891551 6:158644044-158644066 TCATCTTTTATGCCTCCTTGAGG - Intronic
1018998049 6:168725075-168725097 GCAGCTCCTGAGCCTCCCTGGGG + Intergenic
1021555810 7:21916465-21916487 GCATTTTCTTGGCTGCCTTGGGG - Intronic
1021862810 7:24923701-24923723 GCATCTTCCTGGTCTCCTTTGGG - Intronic
1022332092 7:29389679-29389701 GCATGTATTGTGCCTCCTTGGGG + Intronic
1022582595 7:31570893-31570915 GTATCTTCTGCCTCTCCTTGAGG + Intronic
1024171684 7:46794447-46794469 ATATCTCCTGGGACTCCTTGTGG + Intergenic
1028233322 7:88330616-88330638 GCCTCTTCTGGGCCCACCTGTGG + Intergenic
1029115324 7:98233598-98233620 GCACTTTCTTGGCCTCCTTGAGG + Exonic
1029125034 7:98289664-98289686 GCTCCTTCTGGGCCTCCTGGGGG - Intronic
1029170097 7:98624502-98624524 TCCTTTTCTGGGCGTCCTTGGGG + Intronic
1030086401 7:105819530-105819552 CCATCTCCTGGGCCGCCTGGCGG + Intronic
1033563131 7:142553184-142553206 GAATCTTCTGAGCCCACTTGAGG + Intergenic
1034990603 7:155545529-155545551 GCCTCTTCTGGGCCCCCTGCTGG + Intergenic
1035817357 8:2555693-2555715 GGGTATTCTTGGCCTCCTTGAGG - Intergenic
1036282655 8:7414944-7414966 GCAGCTTCTTGGCCTCCTCATGG + Exonic
1036338819 8:7896605-7896627 GCAGCTTCTTGGCCTCCTCATGG - Exonic
1036655141 8:10672919-10672941 GCTCCTTCTGGGCCTGCATGTGG - Intronic
1038047034 8:23774185-23774207 GCAGCTTCCGGGTCTCCATGGGG + Intergenic
1042374444 8:68032931-68032953 CCACCTTCAGGGCCTCCTTAGGG + Intronic
1043439678 8:80266095-80266117 CCATCTCCTGGGCCGCCTGGCGG - Intergenic
1047191098 8:122679644-122679666 GCATCTTCTTGGCTTCCGGGAGG - Intergenic
1049217092 8:141413198-141413220 GCCTCCTCTGGGCCTGCTGGGGG + Intronic
1049419086 8:142509021-142509043 GCATCTTCTCCGCCTCCTAGGGG - Intronic
1054455193 9:65426871-65426893 GCAGGGTCTGGGCCTCCTTAGGG - Intergenic
1056798706 9:89676542-89676564 GCACCTGCTGGGCCTCCCAGGGG - Intergenic
1057147469 9:92767889-92767911 GCATCCTCTGGGTCTCCCTCAGG - Intergenic
1057267567 9:93629497-93629519 GCCTCTTCTTGGCCCCCATGAGG + Intronic
1057929803 9:99183915-99183937 GCATTGCCTGGGACTCCTTGGGG + Intergenic
1059528763 9:115016853-115016875 TCATCTTCTGTGCCTCCTGAGGG + Intergenic
1060300298 9:122371119-122371141 GAATTTTCTTGGCCTCCTGGTGG + Intronic
1060684655 9:125597857-125597879 GCATCCTTTGGTCCTTCTTGAGG - Intronic
1061398051 9:130354201-130354223 GCAACTTGAGGGTCTCCTTGAGG + Intronic
1061812681 9:133171501-133171523 GCATCCTCTCTGCCTCCCTGGGG - Intergenic
1062620165 9:137417017-137417039 GGATCTCCTCGGCCTCCCTGTGG + Intronic
1187337601 X:18394567-18394589 CCATCTGCTGGGCCTCCCAGTGG + Intergenic
1188974999 X:36662377-36662399 GGCTCTTCTGGGCCTCTTTAGGG + Intergenic
1189175231 X:38950039-38950061 GCCTCCTCTGAGCCTCCTTGGGG + Intergenic
1193108456 X:77704402-77704424 GCCTTTTCTGGGCCTGCCTGTGG - Intronic
1197869681 X:131053199-131053221 GCAATTTCTCTGCCTCCTTGGGG + Intergenic
1199195330 X:145022711-145022733 GTATGTTCTTGGCCCCCTTGTGG - Intergenic