ID: 1161512986

View in Genome Browser
Species Human (GRCh38)
Location 19:4682170-4682192
Sequence AATCCCATGCAGTCACCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161512986_1161512995 14 Left 1161512986 19:4682170-4682192 CCCCTAGGTGACTGCATGGGATT No data
Right 1161512995 19:4682207-4682229 CTGGAGACGTGCCAGAAAATGGG 0: 1
1: 0
2: 0
3: 7
4: 101
1161512986_1161512992 -5 Left 1161512986 19:4682170-4682192 CCCCTAGGTGACTGCATGGGATT No data
Right 1161512992 19:4682188-4682210 GGATTCCGGGGAACATTTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 86
1161512986_1161512994 13 Left 1161512986 19:4682170-4682192 CCCCTAGGTGACTGCATGGGATT No data
Right 1161512994 19:4682206-4682228 TCTGGAGACGTGCCAGAAAATGG 0: 1
1: 0
2: 1
3: 9
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161512986 Original CRISPR AATCCCATGCAGTCACCTAG GGG (reversed) Intronic
No off target data available for this crispr