ID: 1161516665

View in Genome Browser
Species Human (GRCh38)
Location 19:4700221-4700243
Sequence TGAGTTCCAGACTGACAGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161516665_1161516666 -10 Left 1161516665 19:4700221-4700243 CCTGGCTGTCAGTCTGGAACTCA 0: 1
1: 0
2: 2
3: 15
4: 197
Right 1161516666 19:4700234-4700256 CTGGAACTCAGCCAGTTTCAAGG 0: 1
1: 0
2: 1
3: 19
4: 217
1161516665_1161516668 0 Left 1161516665 19:4700221-4700243 CCTGGCTGTCAGTCTGGAACTCA 0: 1
1: 0
2: 2
3: 15
4: 197
Right 1161516668 19:4700244-4700266 GCCAGTTTCAAGGCAATCTTGGG 0: 1
1: 0
2: 0
3: 7
4: 107
1161516665_1161516667 -1 Left 1161516665 19:4700221-4700243 CCTGGCTGTCAGTCTGGAACTCA 0: 1
1: 0
2: 2
3: 15
4: 197
Right 1161516667 19:4700243-4700265 AGCCAGTTTCAAGGCAATCTTGG 0: 1
1: 0
2: 0
3: 10
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161516665 Original CRISPR TGAGTTCCAGACTGACAGCC AGG (reversed) Exonic
900094753 1:935853-935875 TGAATTCCAGAGAGGCAGCCTGG + Exonic
901151851 1:7108821-7108843 TGGATTCCTGACTGACAGACAGG - Intronic
902251418 1:15156111-15156133 TGAGGCCCAAACTGCCAGCCTGG + Intronic
903387972 1:22942074-22942096 TGAGTTTCAGTCTGTCACCCAGG + Intergenic
905021959 1:34823940-34823962 TGAGTCCCTGAATGACTGCCTGG + Intronic
905104535 1:35556950-35556972 TGAGAGCCAGGCAGACAGCCGGG - Intronic
907031353 1:51175403-51175425 TGAGTTCCCGACTTACTGCCTGG - Intergenic
907669666 1:56463506-56463528 TGGGTTCCAGCCTGTCTGCCTGG + Intergenic
907720982 1:56971862-56971884 TGAGTTCCTGCATGACTGCCTGG + Intergenic
909546932 1:76858441-76858463 TGAGTGCCACACTGGCTGCCAGG + Intergenic
911078569 1:93905249-93905271 TGAATTCTAGTCAGACAGCCTGG - Intronic
911651290 1:100391808-100391830 AGAGTGGCAGACTGTCAGCCAGG + Intronic
916163839 1:161946529-161946551 TGAGTTCCATAGTTACAACCAGG + Intronic
918489027 1:185060597-185060619 TGTGTTCAGGACTGAGAGCCTGG + Intronic
919201172 1:194357199-194357221 AGAGTTTCTAACTGACAGCCAGG + Intergenic
920119387 1:203644449-203644471 TGAGTTCCAGACTGGAAGTTGGG + Intronic
922854379 1:228761602-228761624 TGAGTTCCCGTATGTCAGCCAGG + Intergenic
923803314 1:237231708-237231730 TGAGTCCCAGACTGCCTGGCTGG - Intronic
924460614 1:244255333-244255355 TGAGGTCCTAACTGACAGCTGGG + Intergenic
1063035521 10:2283226-2283248 AGAGAACCAGACTGGCAGCCTGG + Intergenic
1065487813 10:26251848-26251870 TGAGTTTAAGACTGAGAGCCTGG + Intronic
1065549199 10:26853573-26853595 TGAACTCCAGCCTGGCAGCCTGG - Intronic
1067148873 10:43713303-43713325 CGAGTTCCAGATTTACAGGCAGG - Intergenic
1069671089 10:70204367-70204389 TGGGTGACAGAGTGACAGCCTGG + Intronic
1069686143 10:70320074-70320096 GGACTTCCAGACTGAGAGCACGG + Intronic
1070662132 10:78314579-78314601 TGGGTTCAAGACAGACAGACAGG - Intergenic
1071886622 10:89958234-89958256 TGTGTTCCAGACTGACTGAGAGG - Intergenic
1072239049 10:93478283-93478305 TAAGTTCCATGCGGACAGCCAGG - Intronic
1073364514 10:102927551-102927573 GGAGTTCCAGACTGACAGTCTGG + Intronic
1073480167 10:103781422-103781444 TGAGTTCCTGAATGACTGCCTGG + Intronic
1073853115 10:107644186-107644208 TGAATGTCAGAATGACAGCCAGG - Intergenic
1074723134 10:116280966-116280988 TGAGTCCCAGGATGACTGCCTGG + Intergenic
1074790128 10:116878269-116878291 TCAGAGCCAGACTGGCAGCCAGG + Intronic
1075189544 10:120294109-120294131 TGAACTCCAGCCTGCCAGCCTGG - Intergenic
1075393366 10:122109474-122109496 TGAGTTTCAGTCCCACAGCCTGG + Intronic
1076647753 10:131965123-131965145 TGTGCTCCAGACTGTCAGCGAGG + Intergenic
1077631041 11:3811197-3811219 TGAGTGCCAGCCTGGCTGCCTGG + Intronic
1079321332 11:19454069-19454091 TAAGTTGCAGACTCAGAGCCCGG - Intronic
1079327264 11:19504985-19505007 GGAGTTCGAGACTGAAACCCAGG + Intronic
1079898374 11:26150007-26150029 TGAGTTCCCGTCTGCCACCCAGG + Intergenic
1080694327 11:34588193-34588215 GGATTTCCAGTCTGACAGACTGG + Intergenic
1080700859 11:34642944-34642966 AAGGTTCCAGATTGACAGCCTGG + Intronic
1080781359 11:35432757-35432779 TGAGATCCCGACTGGCAGCGAGG + Exonic
1082817010 11:57515589-57515611 GGAGCTTCAGCCTGACAGCCCGG + Exonic
1084585238 11:70057364-70057386 TGAGTTCTTGATTGAAAGCCTGG + Intergenic
1089048888 11:115528612-115528634 TGACTTCCAGACAGACAGCAAGG - Intergenic
1090956665 11:131519159-131519181 TGAGTTTCAAATTGAGAGCCAGG + Intronic
1091718866 12:2797888-2797910 TGAGATCCAGGCTAAGAGCCAGG + Intronic
1092027942 12:5258681-5258703 TAAGTTCCAGTCTGAAAACCCGG - Intergenic
1095409148 12:41903147-41903169 TGCATTCCAGCCTGGCAGCCTGG + Intergenic
1096620246 12:52860056-52860078 TGTGTTCCTGACTCCCAGCCTGG - Intergenic
1097265525 12:57742225-57742247 TGAGTTTCAAACCCACAGCCTGG + Intronic
1099653511 12:85459363-85459385 TGAACTCCAGCCTGGCAGCCTGG - Intergenic
1104417968 12:128611184-128611206 GGACTTCCTGACTCACAGCCTGG - Intronic
1111258226 13:85700353-85700375 TGAATTCCAGCCTGGCAGCCTGG - Intergenic
1111447738 13:88371860-88371882 TGAGTTTGAGACTCACAGACAGG + Intergenic
1113882226 13:113633682-113633704 TGTGTTCCAGAAGGAGAGCCGGG - Intronic
1113902508 13:113804771-113804793 TTAGTTCCAGCCTGAGAGTCGGG + Intronic
1114255471 14:20998155-20998177 TGAGATGCAGACAGACAGACTGG - Intergenic
1116387581 14:44350345-44350367 TGAGTTTCAGAGTGACTTCCAGG + Intergenic
1118713200 14:68539425-68539447 TGTTTTCCAGACTGAGAGGCAGG - Intronic
1118954603 14:70468606-70468628 TGCATTCCAGCCTGGCAGCCTGG + Intergenic
1122044830 14:99016033-99016055 TGACTGCCAGCCTGCCAGCCTGG - Intergenic
1123773187 15:23549682-23549704 TGATTTACTGACTGACAGGCTGG + Intergenic
1123917851 15:25050394-25050416 TGAGTTCCAGACTGACGTGCTGG + Intergenic
1128233857 15:66053927-66053949 GGAGTTCAAGACCAACAGCCTGG - Intronic
1131265388 15:90912415-90912437 TCAGCTCCAGCCTGACAGCATGG + Intronic
1132246229 15:100298315-100298337 TCAGCTCCAGACTCCCAGCCAGG + Intronic
1133853843 16:9531002-9531024 TGAGTTCCAGATGGCCAGGCTGG + Intergenic
1134689272 16:16180516-16180538 GGAGTTCCACTCTGACACCCAGG + Intronic
1135854432 16:25993728-25993750 TGGGTTGCTGACTGACAACCTGG + Intronic
1136252608 16:29015763-29015785 TGAGCTCCAGCCTGCCGGCCTGG + Intergenic
1136408856 16:30065113-30065135 CGAGTTCCAGGCTGGCAGGCCGG - Intronic
1137334802 16:47537660-47537682 AGATTTCTAGACTGAGAGCCTGG + Intronic
1137507599 16:49068027-49068049 TGAGTGCCTGACTGACAGCAGGG + Intergenic
1137945198 16:52727180-52727202 TGGGTGCCACACTGACAGCATGG + Intergenic
1140452505 16:75082086-75082108 GGAGTTCAAGACCGCCAGCCTGG - Intronic
1143284195 17:5777024-5777046 AGAGTTCCTGACTCCCAGCCTGG + Intronic
1143645134 17:8225064-8225086 GGAGTTCCAGACCAGCAGCCTGG - Intergenic
1143786302 17:9258390-9258412 TGATTTCCAGATTGAGAGGCTGG + Intronic
1144010168 17:11140210-11140232 TAAGTCCCAGGCTGACAGTCTGG + Intergenic
1144841520 17:18189344-18189366 TGAACTCCAGCCTGGCAGCCTGG + Intronic
1148190563 17:45675884-45675906 TGAGTCCCTGAGTGACTGCCTGG - Intergenic
1148224470 17:45889017-45889039 TAAGGTCCTCACTGACAGCCAGG + Intergenic
1148682003 17:49479526-49479548 GGAGTCACGGACTGACAGCCGGG - Intergenic
1153591955 18:6683446-6683468 TGAGGTAGGGACTGACAGCCAGG - Intergenic
1160094493 18:75859549-75859571 TGAGATCCAGAATTTCAGCCTGG - Intergenic
1160714530 19:570365-570387 GGAGTTCAGGACTGGCAGCCTGG - Intergenic
1161516665 19:4700221-4700243 TGAGTTCCAGACTGACAGCCAGG - Exonic
1161918805 19:7250846-7250868 TGAGCTCCAGACTCAGAGCTAGG - Intronic
1162587293 19:11568023-11568045 TGTACTCCAGCCTGACAGCCTGG + Intronic
1162918611 19:13887429-13887451 GGGGATCCAGACAGACAGCCAGG - Intronic
1163130265 19:15268057-15268079 TCAGTTCTAAACTGAGAGCCTGG + Intronic
1163142060 19:15356367-15356389 TGAACTCCAGCCTGGCAGCCTGG + Intronic
1163635910 19:18437215-18437237 TCAGTTCCAGGCTCACAGCCAGG + Intronic
1165309327 19:35021113-35021135 TGAGTCCCAAACTGACCTCCTGG - Intronic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1168316528 19:55486955-55486977 GAAGCTACAGACTGACAGCCAGG + Exonic
925449012 2:3952430-3952452 CGATTTCCAGACTGCCAGCAGGG - Intergenic
928084318 2:28336393-28336415 TGAGTTACAGAGTGACAGGTAGG + Intronic
930243636 2:48961332-48961354 TGAGTTCTAGACTGAGGGTCAGG + Intergenic
932409790 2:71538875-71538897 AGAGATCCAGGCTGGCAGCCTGG + Intronic
933898050 2:86828965-86828987 TGAGTATTACACTGACAGCCAGG - Intronic
934751888 2:96799118-96799140 TGAGTTCCTGAATGACATCTGGG - Exonic
934879997 2:97968417-97968439 TGAATTACACACTGACAGGCAGG - Intronic
937123831 2:119460317-119460339 GGAGTTCTAGACAGAGAGCCAGG - Intronic
939104473 2:137933150-137933172 AGAGTGCCAGACTGGAAGCCAGG - Intergenic
940227383 2:151414014-151414036 TAAATTCTAGATTGACAGCCAGG + Intronic
944288228 2:197975768-197975790 TGAACTCCAGCCTGGCAGCCTGG + Intronic
944788243 2:203095961-203095983 GGAGTTCCAGACCGGCAGCCTGG - Intronic
947265085 2:228269974-228269996 TGAACTCCAGCCTGGCAGCCTGG - Intergenic
948709625 2:239817722-239817744 TGAGGTCCAGGCTAATAGCCAGG - Intergenic
1169563798 20:6830444-6830466 TGATTTCCAGCCTGATAGTCAGG + Intergenic
1170516412 20:17134939-17134961 TTAGTTCCAGTCTGAAGGCCAGG + Intergenic
1170676859 20:18490206-18490228 TCAGTTCTAGACTTACAGCTTGG + Intronic
1172838328 20:37887125-37887147 TGAGTTCCAGGCTGTGTGCCAGG + Intergenic
1172904423 20:38358359-38358381 TGAGTTGCAGACACACAGCAGGG - Intronic
1173821710 20:46023846-46023868 TGAGTTCCAGACCCAGAGCCTGG + Intronic
1175541275 20:59749493-59749515 TGAGAGCCACACTGTCAGCCTGG - Intronic
1175645895 20:60671391-60671413 TGAGTCACAAACTCACAGCCGGG - Intergenic
1178999997 21:37448730-37448752 TGCACTCCAGCCTGACAGCCTGG - Intronic
1179950757 21:44707669-44707691 GGAGTCCCAGAGTGACCGCCTGG + Intronic
1180618441 22:17144136-17144158 GGAGTTCCAGACTTACTGGCTGG - Intronic
1182103418 22:27672628-27672650 TGAGCACCATTCTGACAGCCAGG + Intergenic
1183047280 22:35230077-35230099 TGAGTACCAGACACACAGCGAGG + Intergenic
950658214 3:14450463-14450485 TGAGTACCAAGCTGGCAGCCAGG - Intronic
950797336 3:15520847-15520869 GGGGTTCCACAGTGACAGCCAGG - Intronic
951428165 3:22573901-22573923 TGCCTTCCAGACTGGCACCCTGG - Intergenic
953166340 3:40468347-40468369 GGAGTTCAAGACTGCCAGGCAGG - Intergenic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
955600603 3:60641556-60641578 TTAGGTCCTGAATGACAGCCAGG + Intronic
956280951 3:67556186-67556208 TGTGTTCCTGACTGAAATCCTGG + Intronic
960984568 3:123267151-123267173 TGAGTTTCTGACAGACAGCATGG + Intronic
961501069 3:127336472-127336494 AGAGTTGCAGACAGACAGGCTGG + Intergenic
967639653 3:191846484-191846506 TGAGATTGTGACTGACAGCCTGG + Intergenic
968181920 3:196601727-196601749 TGAGCACCACACTGACAGGCCGG + Intergenic
969250884 4:5968017-5968039 TTGTTTCCAGACTGGCAGCCTGG + Intronic
969250885 4:5968023-5968045 TGAGATCCAGGCTGCCAGTCTGG - Intronic
969252786 4:5980649-5980671 AGAGTCCCAGAATAACAGCCTGG + Intronic
975914010 4:79300990-79301012 TGAGTTCCAGAGTCACACACAGG + Intronic
979947123 4:126845889-126845911 TGAACTCCAGCCTGGCAGCCTGG + Intergenic
981264215 4:142762176-142762198 GGAGTTGCAGAATGAGAGCCAGG - Intronic
981693183 4:147531972-147531994 TGAACTCCAGCCTGGCAGCCTGG + Intronic
982198722 4:152938965-152938987 TGAGCTCCAAACTGACGGCCAGG + Intronic
983370604 4:166852675-166852697 AGGGTGCCATACTGACAGCCTGG - Intronic
985384284 4:189429160-189429182 TGGGATACAGACTGACACCCAGG - Intergenic
986766974 5:10936939-10936961 TGTGCTCCAGCCTGGCAGCCTGG + Intergenic
994654986 5:102581431-102581453 GGAACTCCAGAATGACAGCCAGG - Intergenic
996193642 5:120576737-120576759 TAAATTCCAGTCTGAAAGCCAGG - Intronic
998557766 5:143142346-143142368 GGAGTTCGAGACTAGCAGCCTGG - Intronic
999213752 5:149914150-149914172 TGAGTCCCAATCTCACAGCCAGG - Intronic
1000136395 5:158356570-158356592 TGAGTCTCACACTGATAGCCTGG + Intergenic
1001648697 5:173300417-173300439 TGAGTTCTAGACTAACAGCTGGG + Intergenic
1001720020 5:173849263-173849285 TGAGTTCCTACCTGACAGCCAGG - Intergenic
1002779881 6:357865-357887 TGAACTCTAGTCTGACAGCCAGG + Intergenic
1006774259 6:36579858-36579880 TGAGTTCCAGAGTGCAAGCTAGG + Intergenic
1007589171 6:43011253-43011275 AGAGTTCCTAACTGCCAGCCAGG + Exonic
1009846165 6:69137918-69137940 TGAGTTGCTGAATGACAGCACGG - Intronic
1012905646 6:105061782-105061804 TGAGTTACAGGCTGAAATCCTGG + Intronic
1013470390 6:110458862-110458884 TCAGTCCCAGACTGAAGGCCTGG - Intronic
1014372284 6:120625619-120625641 TGTGTTCCAGAATGCCATCCAGG - Intergenic
1015362995 6:132362471-132362493 TAAGAACCAGACTGACAGTCTGG - Intronic
1016205516 6:141463318-141463340 TTAATTCCAAACTCACAGCCTGG + Intergenic
1018837633 6:167497115-167497137 CCTGTTCCAGGCTGACAGCCTGG + Intergenic
1018844507 6:167546589-167546611 TGGGTCCCAGAGTGACTGCCTGG + Intergenic
1019294434 7:266469-266491 TGAGTCCCAAAAGGACAGCCTGG - Intergenic
1023022345 7:36021651-36021673 TGAGTTTCTGAGTGACTGCCAGG + Intergenic
1023985339 7:45090991-45091013 TGACTTCCAGAATGAAAGCATGG + Intergenic
1029312460 7:99679833-99679855 GGAGCACCAGGCTGACAGCCAGG + Exonic
1029318346 7:99735030-99735052 GGAGTATCAGGCTGACAGCCAGG + Exonic
1029323263 7:99784018-99784040 GGAGCACCAGGCTGACAGCCAGG + Exonic
1029724087 7:102390788-102390810 TGCGTTGCAGACTGGCAGACTGG - Intronic
1030265747 7:107620222-107620244 TAAATTCTAGACTTACAGCCTGG - Exonic
1030285022 7:107817128-107817150 GGAGTTCTAGACTAGCAGCCTGG - Intergenic
1031174763 7:118336471-118336493 TGAGTACCAGACTTGGAGCCAGG - Intergenic
1032404850 7:131648618-131648640 TGGGTCCCACACAGACAGCCAGG - Intergenic
1034196316 7:149250857-149250879 TGAATTACAGGCTGCCAGCCAGG - Intronic
1034910115 7:154989468-154989490 TGAGCACCAAAATGACAGCCTGG + Intronic
1035026643 7:155830850-155830872 AGAATTCCAGATTTACAGCCTGG - Intergenic
1035662931 8:1360853-1360875 TGAGATCCAGACAGAGACCCGGG + Intergenic
1037290565 8:17345429-17345451 TGAGGAGCAGAGTGACAGCCAGG - Intronic
1038144969 8:24887170-24887192 TGGTTCCCAGAGTGACAGCCTGG - Intergenic
1039229191 8:35424492-35424514 TCATTCCTAGACTGACAGCCTGG - Intronic
1041151674 8:54942338-54942360 TGAGTGGCAGACTGGCACCCAGG - Intergenic
1041600967 8:59716942-59716964 TCAGTTCAAGACTGAAGGCCTGG - Intergenic
1044356491 8:91228511-91228533 TGAGTTTCAGGCAGACAGCCTGG + Intronic
1045909863 8:107394407-107394429 TCAGTTCCAGACAGAAGGCCAGG + Intronic
1046788515 8:118294203-118294225 TTCCTTCCACACTGACAGCCAGG + Intronic
1046845470 8:118910490-118910512 TGAAACCCAGAATGACAGCCAGG + Intergenic
1048749952 8:137661658-137661680 TGGGTTCCAGACTGAGCGCATGG - Intergenic
1048884723 8:138900747-138900769 TGAGTCCCAGACTGTGTGCCAGG + Intronic
1050259521 9:3827009-3827031 TGAGTTCCAGTTTGAAGGCCTGG - Intronic
1053545343 9:39017696-39017718 TGAGTTCTTGTCTGACATCCAGG + Intergenic
1053614641 9:39750871-39750893 CGAGTTCCACACTGACCACCAGG + Intergenic
1053809662 9:41839377-41839399 TGAGTTCTTGTCTGACATCCAGG + Intergenic
1053900080 9:42787108-42787130 CGAGTTCCACACTGACCACCAGG - Intergenic
1054238877 9:62591521-62591543 CGAGTTCCACACTGACCACCAGG - Intergenic
1054261556 9:62870488-62870510 CGAGTTCCACACTGACCACCAGG + Intergenic
1054553006 9:66626043-66626065 CGAGTTCCACACTGACCACCAGG - Intergenic
1054620931 9:67348051-67348073 TGAGTTCTTGTCTGACATCCAGG - Intergenic
1059653214 9:116334494-116334516 TGAGTTTCAGGCTGCCTGCCTGG - Intronic
1059734842 9:117090766-117090788 TGAGGTCAGGACTCACAGCCAGG + Intronic
1061054089 9:128212944-128212966 TGAATTGCTGACTGTCAGCCAGG - Intronic
1186555177 X:10550510-10550532 TGAGTGGCAGCCTGGCAGCCTGG - Intronic
1187068190 X:15861523-15861545 TGAGTTCCTGAATGACTGCAAGG + Intergenic
1188710014 X:33384719-33384741 GGAGCACCAGACTGACAGCCAGG - Intergenic
1188813171 X:34678356-34678378 TGACTTCCATTCTGACAACCAGG + Intergenic
1189285876 X:39852142-39852164 TGTGTTCCACACTGTCAACCAGG - Intergenic
1192592127 X:72369048-72369070 TGAGAACCAAACTGAGAGCCTGG - Intronic
1194384115 X:93232177-93232199 TGAGTTCAAGAGTGAGAACCAGG + Intergenic
1200051617 X:153434959-153434981 TGGGTTGTAGACTGACCGCCTGG - Intergenic
1201010013 Y:9542069-9542091 TGCATTCCAGACTGACAGAGTGG + Intergenic
1201504002 Y:14677746-14677768 AGAGTTTCAGTCTGACACCCAGG + Intronic
1201763970 Y:17563089-17563111 TGAGTCCCAGTCTTACACCCAGG + Intergenic
1201837583 Y:18342901-18342923 TGAGTCCCAGTCTTACACCCAGG - Intergenic