ID: 1161517609

View in Genome Browser
Species Human (GRCh38)
Location 19:4705029-4705051
Sequence CTGCTTTCCACAGAGTGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 156}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161517609_1161517613 -3 Left 1161517609 19:4705029-4705051 CCCCTACACTCTGTGGAAAGCAG 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1161517613 19:4705049-4705071 CAGTGTAAACACAAGGACACTGG 0: 1
1: 0
2: 36
3: 1357
4: 17314
1161517609_1161517617 17 Left 1161517609 19:4705029-4705051 CCCCTACACTCTGTGGAAAGCAG 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1161517617 19:4705069-4705091 TGGCTTGGGGACTCAGAGACAGG 0: 1
1: 0
2: 0
3: 31
4: 232
1161517609_1161517612 -10 Left 1161517609 19:4705029-4705051 CCCCTACACTCTGTGGAAAGCAG 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1161517612 19:4705042-4705064 TGGAAAGCAGTGTAAACACAAGG 0: 1
1: 0
2: 0
3: 23
4: 312
1161517609_1161517618 28 Left 1161517609 19:4705029-4705051 CCCCTACACTCTGTGGAAAGCAG 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1161517618 19:4705080-4705102 CTCAGAGACAGGCCAAAGTGAGG 0: 1
1: 0
2: 1
3: 28
4: 247
1161517609_1161517615 3 Left 1161517609 19:4705029-4705051 CCCCTACACTCTGTGGAAAGCAG 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1161517615 19:4705055-4705077 AAACACAAGGACACTGGCTTGGG 0: 1
1: 0
2: 0
3: 34
4: 312
1161517609_1161517616 4 Left 1161517609 19:4705029-4705051 CCCCTACACTCTGTGGAAAGCAG 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1161517616 19:4705056-4705078 AACACAAGGACACTGGCTTGGGG 0: 1
1: 0
2: 1
3: 19
4: 212
1161517609_1161517614 2 Left 1161517609 19:4705029-4705051 CCCCTACACTCTGTGGAAAGCAG 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1161517614 19:4705054-4705076 TAAACACAAGGACACTGGCTTGG 0: 1
1: 0
2: 0
3: 20
4: 296
1161517609_1161517619 29 Left 1161517609 19:4705029-4705051 CCCCTACACTCTGTGGAAAGCAG 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1161517619 19:4705081-4705103 TCAGAGACAGGCCAAAGTGAGGG 0: 1
1: 0
2: 1
3: 30
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161517609 Original CRISPR CTGCTTTCCACAGAGTGTAG GGG (reversed) Intronic
900644052 1:3700983-3701005 CTGCCTTCCTCAGAATGTGGAGG - Intronic
903452296 1:23462458-23462480 CTTTTTTACACAGGGTGTAGTGG - Intronic
904506296 1:30957571-30957593 CAACTTTCCACAGAGAGTAAGGG + Intronic
907928058 1:58973189-58973211 CTGCTTTCCCTAGAGTGTTTAGG - Intergenic
908888284 1:68815013-68815035 CTGCTTTGTACAAAGAGTAGTGG + Intergenic
909325265 1:74343486-74343508 CAGCTTTCCATGGAGTGAAGAGG - Intronic
912551606 1:110488713-110488735 CTGCAGTCCTCAGAGTGTGGTGG - Intergenic
914459766 1:147872593-147872615 ATGCTTTCCACAAATGGTAGTGG + Intergenic
915171884 1:153983734-153983756 CTGATTTCCAGAGATGGTAGTGG + Intronic
917701235 1:177583393-177583415 ATTCTTTCCCCAGAGTGTAGAGG - Intergenic
920229917 1:204463454-204463476 CTGCTTTCCAGAGAGGGCACTGG + Intronic
922303779 1:224326390-224326412 CTGATTTACAAAGAGTGTACAGG - Exonic
922662313 1:227440922-227440944 CTGCTCTCTTCAGAGGGTAGGGG - Intergenic
923552741 1:234977178-234977200 CTGCTTTCTGCTGAGGGTAGAGG + Intergenic
923623783 1:235597963-235597985 CTGTTTTCCCCAGAATGTGGTGG - Intronic
923725656 1:236503188-236503210 CTGCATTCCACAGAGGATTGTGG + Intergenic
1064623194 10:17235502-17235524 CTGCTTTCCACTTTTTGTAGAGG + Intronic
1067934997 10:50602823-50602845 GTTCTTTCCACAGAGAGTAGAGG - Intronic
1069563112 10:69445212-69445234 GCTCTTTCCACAGAGTGTGGGGG - Intergenic
1074523899 10:114248396-114248418 CTGCTCTCCCCAGAGTTAAGAGG - Intronic
1080343607 11:31296745-31296767 CTTCTTTCCACACTGTGAAGAGG - Intronic
1080847908 11:36042520-36042542 CTGCTTTCTACAGAGTGATGGGG - Intronic
1084266226 11:68006730-68006752 CTGCTTTCCACTGAGACTTGAGG + Intergenic
1085746902 11:79122784-79122806 ATGCTTTTCACAGGGTGTGGTGG - Intronic
1088775155 11:113075385-113075407 CTGCTTCCCACACATTTTAGAGG + Intronic
1090952164 11:131483306-131483328 CTTCTCACCACAGAGAGTAGGGG - Intronic
1091442440 12:521892-521914 CTGATTTCCACACAGGCTAGTGG + Intronic
1093128224 12:15356343-15356365 CTTCTTTGCACAGAATGGAGAGG - Intronic
1093315288 12:17642527-17642549 CTGGTTTCCACAGAGTAAAACGG + Intergenic
1095503822 12:42870710-42870732 CTGCTCTGCAGAGTGTGTAGTGG + Intergenic
1096096956 12:48941788-48941810 TGGCATTCCACAGAGTGTAAAGG - Intronic
1097961868 12:65539606-65539628 CTGGTTTCTACAGAGTGTTCTGG + Intergenic
1104066340 12:125310240-125310262 CTGCTTTGCACAGCTTGTGGTGG - Intronic
1104627846 12:130374563-130374585 CAGCTTAACTCAGAGTGTAGAGG - Intergenic
1109691843 13:65904969-65904991 CTGCTTTACACAGAGCCTTGTGG - Intergenic
1113001840 13:105648303-105648325 CTGCCTGCCACAGAGTTGAGAGG - Intergenic
1114361594 14:21979383-21979405 GTGCTTTCTTCAGAGTGTGGAGG - Intergenic
1115103356 14:29730402-29730424 TTGCATTCCCCAGAGTGTACAGG - Intronic
1116467759 14:45253318-45253340 CTGCCGTCCACGGAGTGCAGAGG - Exonic
1117536006 14:56704099-56704121 CTGCCTTCCCCAGAGTGAAGCGG - Intronic
1118720019 14:68587290-68587312 CTGCATTCCACAGAAAGGAGGGG - Intronic
1122079393 14:99256599-99256621 CTGGTTTGCACAGAGAGCAGCGG + Intronic
1124806381 15:32888007-32888029 CTTCTCTACACAGTGTGTAGAGG - Intronic
1128255276 15:66191565-66191587 CTGCTTTCCCCCGAGGGGAGAGG + Intronic
1128460254 15:67861596-67861618 CTGCTTTTCACAGGGGATAGGGG - Intergenic
1130002201 15:80057560-80057582 CTGGTGTCCACAGAGGGTGGGGG - Intergenic
1130808549 15:87352849-87352871 TTGCTTTCCCCAGAGAGCAGGGG + Intergenic
1130909933 15:88263906-88263928 CTGGTTTCCACTAAGAGTAGCGG + Intergenic
1132062846 15:98706848-98706870 ATGCTTCCTACAGAGTTTAGAGG - Intronic
1132366155 15:101258549-101258571 CTACTTCCCTCAGAGTTTAGGGG - Intergenic
1132662807 16:1069135-1069157 CTGCTTTTCAGTGAGTGGAGGGG - Intergenic
1135945874 16:26864600-26864622 CTGCTTTCCTCTGAGTGTCTGGG - Intergenic
1137413723 16:48252185-48252207 CTGTAATCAACAGAGTGTAGTGG - Exonic
1137583490 16:49649511-49649533 CAGTTTTCCAAAGGGTGTAGAGG + Intronic
1139931727 16:70532463-70532485 CTGCTTCCTACAGAGAATAGTGG - Exonic
1140673909 16:77307508-77307530 CAACATTCCTCAGAGTGTAGTGG + Intronic
1140988026 16:80177676-80177698 CTGCTTCCCAGGGAATGTAGAGG - Intergenic
1142002619 16:87672099-87672121 CTGCTATCCCCAGTGTGTGGGGG + Intronic
1143362736 17:6384721-6384743 CTGCTTTCCCCACAGAGGAGAGG - Intergenic
1149922728 17:60674572-60674594 TAGCTTTCCACAGAGTGGAAGGG + Intergenic
1152388229 17:79987771-79987793 TTGGGTTCCACAGAGTTTAGGGG + Intronic
1154238111 18:12625259-12625281 CTGATTTCCACACCGTGTTGCGG + Intronic
1156849279 18:41707495-41707517 CTGCTTTGAACAGATGGTAGTGG - Intergenic
1157483308 18:48069743-48069765 CTGCTCCACTCAGAGTGTAGCGG - Intronic
1158554089 18:58460846-58460868 CTGATTTACACAGGGTATAGTGG + Intergenic
1159434020 18:68392411-68392433 CTTCTTTCCATTAAGTGTAGGGG - Intergenic
1160019056 18:75166315-75166337 CTGCTTTCCACAGCTGGGAGTGG - Intergenic
1160434553 18:78836401-78836423 CTGCTTAGCACTGAGTGGAGGGG - Intergenic
1160655238 19:263390-263412 CTGCTTTCCACCATGTGTTGAGG + Intergenic
1161517609 19:4705029-4705051 CTGCTTTCCACAGAGTGTAGGGG - Intronic
1162545222 19:11325112-11325134 CTGCTTTCCAGGGTGTGTTGAGG - Exonic
1162565888 19:11445760-11445782 TGGCTTTCCCCAGAGCGTAGTGG - Intronic
1165111529 19:33505251-33505273 CTGCTCTCCACAGAAGGCAGCGG + Intronic
925996866 2:9300530-9300552 CAGCTTTCTACAGAGAGTAAAGG + Intronic
928538037 2:32258787-32258809 CTGCTTTTCAGAGTGTGTGGAGG - Intronic
931916967 2:66966973-66966995 ATGCTTTCCAAAAAGTCTAGGGG + Intergenic
932212457 2:69944027-69944049 CTGCTTTCTCCAAAGAGTAGGGG + Intergenic
934308675 2:91844790-91844812 CTCCCTGCCTCAGAGTGTAGTGG + Intergenic
935917675 2:107973401-107973423 CTGCTTGTGACAGAGTGGAGTGG + Intergenic
938680404 2:133684025-133684047 CAGCTCTCCACTGAGTGTATTGG + Intergenic
938992674 2:136645377-136645399 CTGCCTTCCACAGAATGGAGTGG - Intergenic
939010039 2:136835585-136835607 AGGTTTCCCACAGAGTGTAGAGG - Intronic
941843708 2:170113328-170113350 CTGCTCTCCAGAGAATGTATTGG - Intergenic
942207015 2:173629299-173629321 CAGCATTGCACAGAGTGTAGAGG + Intergenic
942634498 2:177988426-177988448 CTGCTTTCCAAATTGTGTAGAGG + Intronic
943267072 2:185745674-185745696 CTGGATCCCTCAGAGTGTAGAGG + Intronic
944877103 2:203973352-203973374 CAGCCTTCCCCAGTGTGTAGAGG - Intergenic
947215108 2:227743246-227743268 CTGCATTCCACAGAGAGGGGAGG + Intergenic
947262746 2:228242287-228242309 CTATTTTGCACAGAGAGTAGGGG + Intergenic
1168974274 20:1952524-1952546 CTTCCTTCCACAGAGGGTACTGG - Intergenic
1170685322 20:18564427-18564449 CGTTTTTCCACAGAATGTAGGGG + Intergenic
1170723518 20:18904695-18904717 CTGCTTTCCTTTGAGTGTTGTGG + Intergenic
1171332595 20:24354364-24354386 CTCTGTTGCACAGAGTGTAGTGG + Intergenic
1176515562 21:7780894-7780916 GGGAATTCCACAGAGTGTAGAGG + Intergenic
1178105202 21:29310786-29310808 ATGGTTTCCACGGAGTGGAGGGG + Intronic
1178649590 21:34410906-34410928 GGGAATTCCACAGAGTGTAGAGG + Intergenic
1179407788 21:41139757-41139779 CTGCTTTCCAGAGAGTAGAGAGG - Intergenic
1182127329 22:27825576-27825598 CTCCTTTCCAGAGACTCTAGAGG + Intergenic
1183530504 22:38350988-38351010 CTGCCTTCCAGAGACTGTACTGG - Intronic
1185084882 22:48735585-48735607 CTGCTTTCCAGAGAGACTGGCGG - Intronic
952101476 3:30017940-30017962 ATGCTTTCTACAGACAGTAGTGG - Intergenic
952103562 3:30043216-30043238 CTGCTTTCCACAGACTGATTAGG + Intergenic
954475309 3:50738549-50738571 CTGCTTTCATCAGATTGTAAGGG + Intronic
955124583 3:56098662-56098684 CTGCTTCCAACAGACTGGAGTGG - Intronic
955709016 3:61759365-61759387 ATGTTTTCCACTGCGTGTAGTGG + Intronic
957227899 3:77473125-77473147 CTGATTCCCACAGGGTTTAGAGG + Intronic
960715177 3:120568177-120568199 CTGCTTACCACAGTGGGGAGCGG - Intergenic
960940491 3:122929901-122929923 CTGCTGTTCAGAGAGAGTAGAGG - Intronic
967118637 3:186363295-186363317 AAGCTTTCCGCAGAGTGTGGAGG + Intergenic
968441105 4:625024-625046 CTGCATCCCTCAGAGTGTGGGGG + Intergenic
969600172 4:8171467-8171489 CTGCTTTCCAGAGAGGGGTGTGG + Intergenic
971774612 4:30946583-30946605 CTGCTTTTCACAGACTGGATAGG - Intronic
972089103 4:35257848-35257870 CTGCTTCGCACAGAGAGTTGTGG + Intergenic
972368909 4:38402745-38402767 ATGCTTTCCATGGAGTGTTGAGG + Intergenic
972765244 4:42147258-42147280 CTGTTTTCCACCGAATGTAATGG - Intronic
975740798 4:77427008-77427030 CTGCCTTCCACAAAGTCTTGGGG + Intronic
976985389 4:91289296-91289318 CTGCTTTCCACAGAATTTCTGGG + Intronic
979429297 4:120608930-120608952 CAGCTTTCAACAGATTGTGGAGG - Intergenic
981479033 4:145217487-145217509 CTGATTCCAACACAGTGTAGAGG - Intergenic
983116654 4:163825936-163825958 CTGCTCTGCACTGGGTGTAGGGG - Intronic
983902582 4:173151853-173151875 CTGCTTTCCACAAAGTTTATAGG - Intergenic
986281775 5:6329259-6329281 CTGAGTTCCACAGGTTGTAGAGG - Intergenic
986393967 5:7310022-7310044 CTGCTTTCCAAAGAGGGTTTTGG - Intergenic
987769243 5:22278788-22278810 TTGCTTTCCACAGAGCAGAGGGG + Intronic
990490532 5:56298751-56298773 CTGCTTTCCACAGCATGGTGGGG + Intergenic
991052350 5:62286950-62286972 CTACTTTCCACAGAGGACAGAGG + Intergenic
992228245 5:74639994-74640016 CTGCTTTCCGCAGAGGAGAGAGG + Intronic
994192750 5:96886452-96886474 TTGTTTTCAACAGAGTGTTGGGG + Intronic
995401015 5:111741716-111741738 CTGCTTTCCAGAATGTGCAGAGG - Intronic
999707207 5:154284343-154284365 CTGCTGTCTTCAGAATGTAGGGG + Intronic
1000541499 5:162546824-162546846 TTTCATTCCACACAGTGTAGAGG + Intergenic
1001529235 5:172450908-172450930 CTGCTTCCAACAGAGGGCAGTGG + Intronic
1007188702 6:39995443-39995465 CTGCTTTCCACAAAAGGTGGAGG + Intergenic
1007325624 6:41057353-41057375 CTGCCTTCCACAGAGGGTTGGGG + Intronic
1007777832 6:44233639-44233661 CTGCTTTCCACGGCGTGTGCTGG + Exonic
1009764907 6:68059614-68059636 CTGCTTTCCAGAGTGAGTGGTGG - Intergenic
1010041392 6:71388991-71389013 CTCTTTGCCACAGAGTGAAGAGG - Intergenic
1017008948 6:150049395-150049417 CTTCTTCCCAAAGAGTCTAGCGG + Intergenic
1018369790 6:163157076-163157098 CTGCCTACCACACAGTGGAGTGG + Intronic
1020720577 7:11739791-11739813 CTGCTTTCCCCAGAAAGCAGAGG + Intronic
1021256515 7:18399079-18399101 CTTCTTTCCACACAGAGCAGTGG - Intronic
1021441786 7:20685765-20685787 ATGCTCTTCACAGAGTGCAGAGG - Exonic
1021861239 7:24907869-24907891 TTACTTTCCACAGAATGTAGAGG - Intronic
1022293808 7:29030422-29030444 CTACTTTCCACAGAGAAGAGTGG - Intronic
1023042365 7:36182948-36182970 CTGCTTTCCACAAAGGGAAGGGG - Intronic
1028062245 7:86336780-86336802 ATGCTTTCCAAAAAGTGTATGGG - Intergenic
1033024326 7:137757948-137757970 CTGATTTCCCCAGGGTGCAGAGG - Intronic
1037759077 8:21729972-21729994 CTGAATTCCCCAGAGTGTGGTGG - Intronic
1037897955 8:22670714-22670736 CTGCTTTGCAGAGAGTGTGACGG + Intergenic
1041698484 8:60762387-60762409 CTGCCTTCCAAAGTGTGCAGAGG - Intronic
1041737441 8:61126297-61126319 CTGCTTTCTCCACAGTGCAGTGG - Intronic
1043687038 8:83100124-83100146 CTGCTTTCCACAAATTGTGAAGG - Intergenic
1044618973 8:94170584-94170606 CTGCTTTTGACAGAGGGTGGTGG - Intronic
1045556316 8:103218074-103218096 CTGCTTTCCAAAGGGTGATGGGG + Intronic
1049051435 8:140200008-140200030 CTGCTTCTCACAGGGTGCAGAGG + Intronic
1051083513 9:13320527-13320549 CTGCTTTCTACAGAATGAATTGG - Intergenic
1052566740 9:30163132-30163154 CTGATTTCCACAGGGTGTTAGGG - Intergenic
1052677964 9:31651157-31651179 CTGATTTACACTGGGTGTAGTGG + Intergenic
1054789193 9:69239218-69239240 CTGGTTTCCACACAGTGAAACGG - Intronic
1054789204 9:69239342-69239364 CTGGTTTCCACACAGTGAAATGG - Intronic
1056042502 9:82682758-82682780 CTGCCTCCCACAGGGTGCAGTGG - Intergenic
1056121667 9:83494238-83494260 CTGTTCTCCACAGTGTGTGGAGG + Intronic
1060944686 9:127563055-127563077 CTGCTGTCCAAGGAGTGAAGCGG - Intronic
1061560954 9:131402832-131402854 CTGCTTTCCAGAGAGTGCCGAGG + Intronic
1186788159 X:12972444-12972466 GTGCTTTCCACAGCGTCTGGTGG - Intergenic
1187394320 X:18906682-18906704 CAGCCTTCCTCAGAGTGGAGGGG - Intronic
1190947916 X:55113908-55113930 CTGCTTTCCATAGTGGGGAGTGG + Intronic
1194487219 X:94499250-94499272 CTCCTCTCCACAGTGTGTAATGG - Intergenic
1197631245 X:128861887-128861909 GTACTTTCAAGAGAGTGTAGGGG + Intergenic
1198053057 X:132967317-132967339 CTGCTTTTCACAGGGAGAAGAGG + Intergenic