ID: 1161517610

View in Genome Browser
Species Human (GRCh38)
Location 19:4705030-4705052
Sequence ACTGCTTTCCACAGAGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 159}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161517610_1161517617 16 Left 1161517610 19:4705030-4705052 CCCTACACTCTGTGGAAAGCAGT 0: 1
1: 0
2: 1
3: 8
4: 159
Right 1161517617 19:4705069-4705091 TGGCTTGGGGACTCAGAGACAGG 0: 1
1: 0
2: 0
3: 31
4: 232
1161517610_1161517613 -4 Left 1161517610 19:4705030-4705052 CCCTACACTCTGTGGAAAGCAGT 0: 1
1: 0
2: 1
3: 8
4: 159
Right 1161517613 19:4705049-4705071 CAGTGTAAACACAAGGACACTGG 0: 1
1: 0
2: 36
3: 1357
4: 17314
1161517610_1161517619 28 Left 1161517610 19:4705030-4705052 CCCTACACTCTGTGGAAAGCAGT 0: 1
1: 0
2: 1
3: 8
4: 159
Right 1161517619 19:4705081-4705103 TCAGAGACAGGCCAAAGTGAGGG 0: 1
1: 0
2: 1
3: 30
4: 295
1161517610_1161517618 27 Left 1161517610 19:4705030-4705052 CCCTACACTCTGTGGAAAGCAGT 0: 1
1: 0
2: 1
3: 8
4: 159
Right 1161517618 19:4705080-4705102 CTCAGAGACAGGCCAAAGTGAGG 0: 1
1: 0
2: 1
3: 28
4: 247
1161517610_1161517616 3 Left 1161517610 19:4705030-4705052 CCCTACACTCTGTGGAAAGCAGT 0: 1
1: 0
2: 1
3: 8
4: 159
Right 1161517616 19:4705056-4705078 AACACAAGGACACTGGCTTGGGG 0: 1
1: 0
2: 1
3: 19
4: 212
1161517610_1161517615 2 Left 1161517610 19:4705030-4705052 CCCTACACTCTGTGGAAAGCAGT 0: 1
1: 0
2: 1
3: 8
4: 159
Right 1161517615 19:4705055-4705077 AAACACAAGGACACTGGCTTGGG 0: 1
1: 0
2: 0
3: 34
4: 312
1161517610_1161517614 1 Left 1161517610 19:4705030-4705052 CCCTACACTCTGTGGAAAGCAGT 0: 1
1: 0
2: 1
3: 8
4: 159
Right 1161517614 19:4705054-4705076 TAAACACAAGGACACTGGCTTGG 0: 1
1: 0
2: 0
3: 20
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161517610 Original CRISPR ACTGCTTTCCACAGAGTGTA GGG (reversed) Intronic
901556401 1:10034652-10034674 ACTGCTTTCCTAATACTGTAGGG - Intronic
901723142 1:11216607-11216629 ACTGCACTCTACAGAGTGCAGGG + Intronic
904506295 1:30957570-30957592 ACAACTTTCCACAGAGAGTAAGG + Intronic
906228197 1:44139156-44139178 TCTGCTCTCCACAGAGGGTCTGG + Intergenic
906228225 1:44139282-44139304 TCTGCTCTCCACAGAGGGTCTGG + Intergenic
906228279 1:44139534-44139556 TCTGCTCTCCACAGAGGGTCTGG + Intergenic
906228312 1:44139702-44139724 TCTGCTCTCCACAGAGGGTCTGG + Intergenic
906228350 1:44139870-44139892 TCTGCTCTCCACAGAGGGTCTGG + Intergenic
906228379 1:44139996-44140018 TCTGCTCTCCACAGAGGGTCTGG + Intergenic
906228433 1:44140248-44140270 TCTGCTCTCCACAGAGGGTCTGG + Intergenic
906228532 1:44140752-44140774 TCTGCTCTCCACAGAGGGTCTGG + Intergenic
906228550 1:44140836-44140858 TCTGCTCTCCACAGAGGGTCTGG + Intergenic
907990255 1:59574541-59574563 ACTTCTTTCCATAAAGGGTATGG - Intronic
908887157 1:68802488-68802510 AATGCTTTACACAAAGTTTATGG + Intergenic
916007629 1:160676536-160676558 ACTGGCTTTCACAGAGTGTTGGG + Intergenic
919977786 1:202623768-202623790 ACTGCTTTCTGCAGAGTGCGTGG + Intronic
920122853 1:203671920-203671942 ACTGCTACCCACAGAGGGGATGG + Intronic
920388894 1:205586590-205586612 ACAGCTTTCCACTGACTGGAGGG - Intronic
922346550 1:224701162-224701184 ACTGCTATGCAGAGAGTGGAAGG + Intronic
1064086212 10:12348728-12348750 ACTTCTTTCCACTGAGTCTCTGG + Intergenic
1066492650 10:35908328-35908350 ACTACTTTCAACAGGGTGGATGG + Intergenic
1069247514 10:66224810-66224832 ACTGCTTTCAAAAAACTGTAAGG - Intronic
1069563113 10:69445213-69445235 AGCTCTTTCCACAGAGTGTGGGG - Intergenic
1069655302 10:70083360-70083382 ACTGCTTGCCACAGAGATTTGGG - Intronic
1075569805 10:123531847-123531869 ACTGCTTTCCACAGTGGCTGAGG + Intergenic
1076225521 10:128771874-128771896 AATGCTTTCCACATAGTGGGAGG + Intergenic
1076381086 10:130024947-130024969 AATGCTATCCACAGGGTGCATGG + Intergenic
1078008207 11:7548416-7548438 CCTGTTCTCCACAGCGTGTATGG + Intronic
1078312052 11:10254021-10254043 ACTCCTTCCAACAGTGTGTAAGG - Intronic
1079425444 11:20337743-20337765 TGTGCTTTCCACGGAGTTTACGG + Intergenic
1080847909 11:36042521-36042543 TCTGCTTTCTACAGAGTGATGGG - Intronic
1081108091 11:39098019-39098041 ATTGCTTTCAACAGAGGCTATGG + Intergenic
1085088540 11:73690017-73690039 ACTTCTTTTCACATGGTGTAAGG + Intronic
1089847358 11:121468754-121468776 TTTGCTTTCCACAGAGTGGGTGG + Intronic
1090468706 11:126958971-126958993 ACTGCTTTCCTCAATGTGGATGG + Intronic
1093894394 12:24561203-24561225 ACTGCCTGGCACCGAGTGTAGGG + Intergenic
1094289473 12:28830798-28830820 ACTGCTTTCCGCAGCATGCAGGG + Intergenic
1101221799 12:102649291-102649313 TCTGCTTGCAACATAGTGTATGG - Intergenic
1104202264 12:126601112-126601134 ACTGCTTTCCACACAGTAGAAGG - Intergenic
1109932096 13:69229187-69229209 ACTGCTTTCCACAGGGACTGAGG + Intergenic
1110513295 13:76379175-76379197 ATTGCTATCCACTGAGTCTATGG - Intergenic
1111808788 13:93071629-93071651 ACTGCTTTCCACAGTGGTTGAGG - Intergenic
1120212349 14:81645935-81645957 TCTTCTTTCCACAGAGTGCTGGG - Intergenic
1120761209 14:88287199-88287221 ATTGTTTTTCACAGGGTGTAAGG - Intronic
1127046543 15:55032100-55032122 ACTGCCTTCCACAAAGTTTGAGG + Intergenic
1128687222 15:69695777-69695799 ACTTCTTACCACGGAGTGAAAGG + Intergenic
1129622117 15:77157266-77157288 ACTGGTTTCCAAACAGTCTAAGG + Intronic
1130002202 15:80057561-80057583 ACTGGTGTCCACAGAGGGTGGGG - Intergenic
1130869487 15:87959119-87959141 ACTCCTTTCCACTGAGTGGTTGG - Intronic
1135945875 16:26864601-26864623 TCTGCTTTCCTCTGAGTGTCTGG - Intergenic
1136542726 16:30937335-30937357 ACTGCTTTCCTCGGAGTCTCAGG + Intronic
1137932109 16:52598718-52598740 ACTTCTTGCCCCAGGGTGTATGG + Intergenic
1138033314 16:53578490-53578512 ACTGCTTTCTACAGAGTAGAAGG + Intergenic
1141230293 16:82160937-82160959 GTTGCTTTCCTCTGAGTGTAGGG - Intronic
1141974637 16:87507399-87507421 GCTGCTTTCCACAGGGTGGTGGG + Intergenic
1142749958 17:1981451-1981473 TCTGCTTTCCAGAGACTTTAGGG + Intronic
1142893593 17:2960541-2960563 CCTGCTGTCCACAGAGTGTGGGG + Intronic
1149254806 17:54814025-54814047 TTTGTTTTCCAAAGAGTGTAAGG + Intergenic
1149922727 17:60674571-60674593 TTAGCTTTCCACAGAGTGGAAGG + Intergenic
1152779826 17:82221973-82221995 ACTGCTTTCCACGGAGGCTTTGG - Intergenic
1153114494 18:1639013-1639035 ACTGCTCTCTACATAGTATAAGG + Intergenic
1155557355 18:27034536-27034558 ACTGCTTCCCACAGTCTATAAGG + Intronic
1156426664 18:37020698-37020720 ATTGCTTTCCAGAAGGTGTATGG + Intronic
1160103619 18:75947705-75947727 TCTGCTTTCCACAGAGCCTTTGG - Intergenic
1161517610 19:4705030-4705052 ACTGCTTTCCACAGAGTGTAGGG - Intronic
1162966792 19:14159987-14160009 ACTCCTTTCCTCAGAGAGGAAGG - Intronic
1163396233 19:17063665-17063687 ACTGCCCTCCCCAGTGTGTATGG + Intronic
925561660 2:5202906-5202928 ACTGCCTTCCACAGTGTGGGTGG + Intergenic
928653217 2:33423371-33423393 CCTGCTTTCCACAGAGCTGAGGG + Intergenic
932011682 2:67984165-67984187 ACTGCTTTCCAAAAAGTGATGGG - Intergenic
935967251 2:108493028-108493050 ACTCCTTTCCATTGAGGGTAAGG - Intronic
936404013 2:112186684-112186706 AGTGCTTCCCACACGGTGTACGG - Intronic
936786297 2:116097582-116097604 ACTGATTTCCTCAGAGTTGATGG - Intergenic
937891731 2:126944301-126944323 ACTGCATTCCACATACTGTTTGG + Intergenic
939134317 2:138275395-138275417 ACTGCATTCCACATAGGGTTTGG - Intergenic
947262745 2:228242286-228242308 ACTATTTTGCACAGAGAGTAGGG + Intergenic
947392190 2:229650876-229650898 AGTGCTTTCTATAGAGTGGATGG + Intronic
947957999 2:234211976-234211998 AGTGCTTTCCAGAGAGTGTTTGG + Intergenic
948897284 2:240933364-240933386 ACGGCCTTGCACAGGGTGTATGG + Intronic
1170685321 20:18564426-18564448 ACGTTTTTCCACAGAATGTAGGG + Intergenic
1170786734 20:19473716-19473738 AATGCTGTCCACAGAGGGTCTGG + Intronic
1172315656 20:33952174-33952196 ACTGCCTTCCAAGGAGGGTAGGG - Intergenic
1174163341 20:48567308-48567330 ACTGGCTTCCCCAGAGTGTTGGG - Intergenic
1175754835 20:61522895-61522917 TCTGCTGTACACAGAGTGCAGGG + Intronic
1177693560 21:24541486-24541508 TCTGCTTTCCACAGAGTCCTAGG + Intergenic
1178105201 21:29310785-29310807 AATGGTTTCCACGGAGTGGAGGG + Intronic
1178216428 21:30604467-30604489 ACTGCTTATCAGAGAGTGGAAGG + Intergenic
1180153725 21:45966841-45966863 ACTCCTTTCCCCAGGGTCTAGGG - Intergenic
1180686913 22:17675951-17675973 CCTGCTTTCCACACTGTGAAAGG - Intronic
1182028202 22:27136840-27136862 ACAGCTTTCCCCAGAGTGGGTGG - Intergenic
1182942698 22:34293003-34293025 ACTGCTTTCTTCAGCGTGTGTGG + Intergenic
1183831646 22:40421243-40421265 TCTGCTTTTCACGGGGTGTACGG - Intronic
952040696 3:29258059-29258081 ACTGGTTTCCACAATGTGTTTGG - Intergenic
952786592 3:37161533-37161555 AGTGCTTTCCACAAAGTCTCGGG + Intronic
953471211 3:43168413-43168435 ACTCAGTTCCACAGACTGTACGG - Intergenic
953777500 3:45833505-45833527 ATTGTTTTTCACAGAGTCTAAGG - Intronic
954475308 3:50738548-50738570 TCTGCTTTCATCAGATTGTAAGG + Intronic
954933521 3:54305620-54305642 ACTGCTTCCTACACAGTGTCAGG - Intronic
955512034 3:59691059-59691081 AAATCTTTCCACAGAGTCTAAGG - Intergenic
962496446 3:135945057-135945079 ACTGTATTCCCCAGAGAGTAGGG + Intergenic
963993973 3:151685250-151685272 ATTCCTTTCCCCAGGGTGTAGGG - Intergenic
966351169 3:179033834-179033856 ACTGCAATCCAGAGACTGTAAGG + Intronic
967610095 3:191494878-191494900 ACTTCCTTCCAAAGAATGTATGG - Intergenic
967779144 3:193417646-193417668 ACTGCTTTCAACAGTGTGCTGGG + Intronic
967850456 3:194078792-194078814 ACTACTTTCCACAGTTTTTATGG + Intergenic
971202580 4:24524940-24524962 ACTGCAATCCACAGAGTATTTGG + Intronic
975310971 4:72903629-72903651 ATTGCTTTCAACTGAGGGTAAGG - Intergenic
976985388 4:91289295-91289317 TCTGCTTTCCACAGAATTTCTGG + Intronic
977887305 4:102267384-102267406 TCTGCTTTCCGCAGTGTGGAAGG - Intronic
979230667 4:118345959-118345981 ATTTCTTTCCAAAGAGTGTCAGG + Intronic
988225574 5:28407800-28407822 ACTGCTTCCTACTGAGTTTATGG + Intergenic
988695565 5:33618950-33618972 ACTCCTTTCCAAAGAGTATTGGG + Intronic
991111726 5:62907738-62907760 ACTTCTTTCCAAAGAGTATGGGG - Intergenic
991268702 5:64753135-64753157 ATTGCTTTCCTCAAAGTGTTAGG + Intronic
993329193 5:86576004-86576026 CGTCCTTCCCACAGAGTGTAAGG + Intergenic
993891410 5:93479127-93479149 GCTGCTTTCCACAGGGCTTAAGG - Intergenic
994608207 5:101998296-101998318 AATGCTTTCCAGAGAATGTAAGG + Intergenic
995995580 5:118294313-118294335 ACTGCTTTCCATCCATTGTATGG - Intergenic
997508581 5:134437672-134437694 ACTCCTTTGCACACAGTCTATGG + Intergenic
1000660495 5:163932940-163932962 CCCCCTTTCCAGAGAGTGTAAGG - Intergenic
1007325623 6:41057352-41057374 CCTGCCTTCCACAGAGGGTTGGG + Intronic
1007563437 6:42829735-42829757 ACTGCTGTCCACTTAGTGTCTGG + Exonic
1007869176 6:45013366-45013388 ACTGCTTGGAACAGAGTGTGTGG - Intronic
1009808133 6:68628777-68628799 GCTGCTTACCACAGGGTATAAGG + Intergenic
1010129818 6:72478289-72478311 ACTGGTCCCCACAGAGTTTAAGG + Intergenic
1010595713 6:77761250-77761272 ACAGCTTTCCACAAAGTGCTGGG - Exonic
1017226039 6:152022180-152022202 TCTGCTTTCCTCAGAGGCTAAGG - Intronic
1018041500 6:159926933-159926955 ACTGCCTTCCCCAGCGTGGATGG + Intergenic
1018503132 6:164434067-164434089 ACTGCTTTCCAAAGAATCTGTGG - Intergenic
1023042366 7:36182949-36182971 ACTGCTTTCCACAAAGGGAAGGG - Intronic
1026222985 7:68416373-68416395 ACTGCATTCCACACAGCGTTTGG + Intergenic
1028062246 7:86336781-86336803 TATGCTTTCCAAAAAGTGTATGG - Intergenic
1028389105 7:90294871-90294893 ACTGGTTTGCACAGAGGGGAAGG + Intronic
1028450732 7:90979461-90979483 CATGCTTACCTCAGAGTGTAGGG - Intronic
1029984319 7:104908776-104908798 ATTTCATTCCACTGAGTGTATGG - Intergenic
1030281940 7:107785401-107785423 ACCTCTCTCCACAGTGTGTAGGG - Intronic
1031316817 7:120268931-120268953 ACTGCTTTCCACAGTGATCATGG - Intergenic
1031329397 7:120445597-120445619 ACTGCTTAGCACATAGTGAATGG + Intronic
1031605712 7:123764513-123764535 ACTGCCTAGCACAGAGTCTAGGG + Intergenic
1031789511 7:126083716-126083738 ACTGCATCCCACAGAATGAAGGG + Intergenic
1033310628 7:140259479-140259501 ACTGCTCTCCACAGACTGAGAGG - Intergenic
1033716664 7:144009687-144009709 ACTGGTTTCCACATGGTGTTGGG + Intergenic
1041515011 8:58690757-58690779 CATTCTGTCCACAGAGTGTATGG + Intergenic
1042041616 8:64597658-64597680 ACTGCTTTACCTAGAGTGTTGGG + Intronic
1042624896 8:70747333-70747355 ACTGCTTTCCACAGGGGATTGGG + Intronic
1043101696 8:76055265-76055287 ACTAGTTTCCATAGAGTGTCTGG - Intergenic
1045556315 8:103218073-103218095 ACTGCTTTCCAAAGGGTGATGGG + Intronic
1046332767 8:112742438-112742460 ACAGCTTTCCACAGTGTGTAAGG - Intronic
1047458934 8:125043360-125043382 ACTGCTTTCTGCAGAGTATAAGG + Intronic
1049504661 8:142989615-142989637 ACTCCTTTCAGCAGAGTGTCTGG - Intergenic
1049985665 9:948487-948509 ACTGACTTCCACAGACTCTAGGG - Intronic
1050673110 9:8020132-8020154 ACTGAGCTGCACAGAGTGTATGG + Intergenic
1052566741 9:30163133-30163155 GCTGATTTCCACAGGGTGTTAGG - Intergenic
1054769065 9:69067555-69067577 AATCTTTTCCACAGAGAGTATGG - Intronic
1055779256 9:79801508-79801530 ACTGCTTTCCCAAGCTTGTACGG + Intergenic
1056070521 9:82982117-82982139 ACTGCTTCCCACAGAATCTGAGG + Exonic
1056738112 9:89226854-89226876 ACTGCTTTTCATCGAGTGTTGGG + Intergenic
1056767036 9:89450809-89450831 ACTGCACTTCACAGAGTCTAGGG - Intronic
1060648394 9:125302618-125302640 ATTGTTTTCCACATAGTTTAAGG + Exonic
1185833974 X:3328540-3328562 ACTGCTTTGTAGAGAGTGAATGG + Intronic
1187394321 X:18906683-18906705 ACAGCCTTCCTCAGAGTGGAGGG - Intronic
1189216116 X:39325929-39325951 ACTGCTTTCCACAGGGGGAGAGG + Intergenic
1190591253 X:52003997-52004019 ACTGCTCTCCTCACAGTGTTTGG - Intergenic
1192249486 X:69399554-69399576 TCTGCCTTCCACAGAGTCTTAGG + Intergenic
1194211554 X:91076217-91076239 ACTGCTTCCCAGACAATGTAAGG - Intergenic
1195556081 X:106226252-106226274 ACTGCTTTCCAAAGTGACTATGG - Intergenic
1197631244 X:128861886-128861908 AGTACTTTCAAGAGAGTGTAGGG + Intergenic
1199357386 X:146877340-146877362 ACTGCTTTCCACAGTGGCTGAGG - Intergenic
1201225412 Y:11813797-11813819 ACTGGTTTCCACAGAGACCAAGG + Intergenic