ID: 1161517611

View in Genome Browser
Species Human (GRCh38)
Location 19:4705031-4705053
Sequence CACTGCTTTCCACAGAGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 186}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161517611_1161517619 27 Left 1161517611 19:4705031-4705053 CCTACACTCTGTGGAAAGCAGTG 0: 1
1: 0
2: 2
3: 14
4: 186
Right 1161517619 19:4705081-4705103 TCAGAGACAGGCCAAAGTGAGGG 0: 1
1: 0
2: 1
3: 30
4: 295
1161517611_1161517617 15 Left 1161517611 19:4705031-4705053 CCTACACTCTGTGGAAAGCAGTG 0: 1
1: 0
2: 2
3: 14
4: 186
Right 1161517617 19:4705069-4705091 TGGCTTGGGGACTCAGAGACAGG 0: 1
1: 0
2: 0
3: 31
4: 232
1161517611_1161517616 2 Left 1161517611 19:4705031-4705053 CCTACACTCTGTGGAAAGCAGTG 0: 1
1: 0
2: 2
3: 14
4: 186
Right 1161517616 19:4705056-4705078 AACACAAGGACACTGGCTTGGGG 0: 1
1: 0
2: 1
3: 19
4: 212
1161517611_1161517614 0 Left 1161517611 19:4705031-4705053 CCTACACTCTGTGGAAAGCAGTG 0: 1
1: 0
2: 2
3: 14
4: 186
Right 1161517614 19:4705054-4705076 TAAACACAAGGACACTGGCTTGG 0: 1
1: 0
2: 0
3: 20
4: 296
1161517611_1161517615 1 Left 1161517611 19:4705031-4705053 CCTACACTCTGTGGAAAGCAGTG 0: 1
1: 0
2: 2
3: 14
4: 186
Right 1161517615 19:4705055-4705077 AAACACAAGGACACTGGCTTGGG 0: 1
1: 0
2: 0
3: 34
4: 312
1161517611_1161517618 26 Left 1161517611 19:4705031-4705053 CCTACACTCTGTGGAAAGCAGTG 0: 1
1: 0
2: 2
3: 14
4: 186
Right 1161517618 19:4705080-4705102 CTCAGAGACAGGCCAAAGTGAGG 0: 1
1: 0
2: 1
3: 28
4: 247
1161517611_1161517613 -5 Left 1161517611 19:4705031-4705053 CCTACACTCTGTGGAAAGCAGTG 0: 1
1: 0
2: 2
3: 14
4: 186
Right 1161517613 19:4705049-4705071 CAGTGTAAACACAAGGACACTGG 0: 1
1: 0
2: 36
3: 1357
4: 17314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161517611 Original CRISPR CACTGCTTTCCACAGAGTGT AGG (reversed) Intronic
901723141 1:11216606-11216628 CACTGCACTCTACAGAGTGCAGG + Intronic
903748876 1:25606756-25606778 CACAGCTGTGCAAAGAGTGTTGG - Intergenic
908295686 1:62710571-62710593 TACTGATTTACACAGAGGGTAGG - Intergenic
910573985 1:88737650-88737672 CACAGGTTTCCACATAGTATCGG + Intronic
913129619 1:115828120-115828142 CACTGCTGTCCACAAAGGGCCGG + Intergenic
913569402 1:120105119-120105141 CAGTGGTGTCCACACAGTGTGGG + Intergenic
914290212 1:146266106-146266128 CAGTGGTGTCCACACAGTGTGGG + Intergenic
914551255 1:148716889-148716911 CAGTGGTGTCCACACAGTGTGGG + Intergenic
916007628 1:160676535-160676557 CACTGGCTTTCACAGAGTGTTGG + Intergenic
918631082 1:186719302-186719324 CACTTCTCTCCTCAGAGTATTGG - Intergenic
919493033 1:198229026-198229048 CATTCCTTTCCCCAGAGTATGGG - Intronic
919841710 1:201614108-201614130 CACTGCACAGCACAGAGTGTTGG - Intergenic
920388895 1:205586591-205586613 CACAGCTTTCCACTGACTGGAGG - Intronic
921658604 1:217771247-217771269 CACAGATTTCCCCATAGTGTTGG + Intronic
922325296 1:224522824-224522846 CACTGTTTTCCAAAGTATGTGGG - Intronic
1064365907 10:14707620-14707642 CACAGCTTTCAGCAGAGAGTGGG - Intronic
1064388334 10:14919670-14919692 CACTGCTTTCCAGGGAGCTTGGG - Intronic
1065622366 10:27595434-27595456 CACTTCTATCAACATAGTGTTGG - Intergenic
1067008293 10:42685990-42686012 CACTGCCTTCTACAGAATGATGG + Intergenic
1067360808 10:45576420-45576442 CATATCTTTGCACAGAGTGTAGG + Intronic
1069563114 10:69445214-69445236 GAGCTCTTTCCACAGAGTGTGGG - Intergenic
1069655303 10:70083361-70083383 CACTGCTTGCCACAGAGATTTGG - Intronic
1070852217 10:79574444-79574466 CACTCCTTTCAACATAGTGTTGG + Intergenic
1079106235 11:17574146-17574168 TACTGGATCCCACAGAGTGTAGG + Intronic
1080513305 11:32997044-32997066 CACTCCCTTCAACATAGTGTTGG - Intergenic
1080759021 11:35229766-35229788 CATTGCTTTCCACTGAGGTTGGG + Exonic
1080847910 11:36042522-36042544 TTCTGCTTTCTACAGAGTGATGG - Intronic
1083128951 11:60603495-60603517 CACTCCATTCAACATAGTGTTGG + Intergenic
1084091751 11:66883293-66883315 CACTGCTTTCCAGTGAGGCTGGG - Intronic
1084638629 11:70410773-70410795 CACTTCTTTCCACAGAGTAAAGG - Intronic
1086725106 11:90172363-90172385 CACTGCCATCCACAGAGTAATGG - Intronic
1086771677 11:90774877-90774899 CACATCTTTCCTCAGTGTGTGGG - Intergenic
1089735530 11:120548005-120548027 AACTGCTGTCCACAGGGTGAAGG + Intronic
1092288412 12:7143300-7143322 CACTGCTGTCAAGTGAGTGTTGG + Exonic
1097317055 12:58182880-58182902 CATTGCTTTACACAGACAGTGGG + Intergenic
1105787023 13:23759715-23759737 CACCCCTTTCCACAGAATGGAGG - Intronic
1106474019 13:30081885-30081907 CAGTGCTTTCCACACAATGATGG + Intergenic
1106519870 13:30487172-30487194 CACTTCCATCCACAAAGTGTTGG - Intronic
1109083071 13:57932258-57932280 CACTGCTTGCCAAATAGAGTTGG + Intergenic
1109441226 13:62378014-62378036 CCTTGCTTTGCACAAAGTGTAGG - Intergenic
1113067143 13:106383945-106383967 CACTGCATTCAGCTGAGTGTTGG - Intergenic
1113189474 13:107727462-107727484 CCCTGTTGTCCACAGAGTATGGG - Intronic
1113440847 13:110326816-110326838 CACTGCCTTCCCTTGAGTGTGGG + Intronic
1113458301 13:110464457-110464479 CACTGCTGTCCACTAAGTTTGGG + Intronic
1117589084 14:57246514-57246536 ATTGGCTTTCCACAGAGTGTTGG - Intronic
1117769471 14:59118525-59118547 CACTTCTAACCACAGAGGGTTGG - Intergenic
1119433369 14:74582868-74582890 CACTGCTTTCCAAAGCCTGCTGG + Intronic
1120212350 14:81645936-81645958 TTCTTCTTTCCACAGAGTGCTGG - Intergenic
1121428856 14:93873059-93873081 CACTGCTTCCTCCAGAGTCTGGG - Intergenic
1124576386 15:30912606-30912628 CACTGCATCCCAGAGGGTGTGGG - Intronic
1127064017 15:55218206-55218228 CACTACTTTTCACAGTCTGTTGG + Intronic
1128931524 15:71708902-71708924 CACAGCTGTGCACAGAGCGTGGG + Intronic
1130002203 15:80057562-80057584 CACTGGTGTCCACAGAGGGTGGG - Intergenic
1133636880 16:7675235-7675257 CACTGAGTTCAACAGAGTGACGG - Intronic
1134438369 16:14282300-14282322 TGCTGCCTTCCACAGAGTGAGGG - Intergenic
1135760511 16:25134273-25134295 CAGTGACTTCAACAGAGTGTGGG + Intronic
1136687463 16:32003614-32003636 CGCTGGTCTCCAGAGAGTGTCGG - Intergenic
1136881707 16:33906624-33906646 CGCTGGTCTCCAGAGAGTGTCGG + Intergenic
1136894474 16:33988632-33988654 CAGGGCTTTCCTTAGAGTGTGGG - Intergenic
1137522260 16:49204427-49204449 CAGTGCCTTCCGCAGAGTGGGGG - Intergenic
1138811029 16:60150720-60150742 CACTGCTTTCCACAAGGCGAAGG - Intergenic
1139112848 16:63913048-63913070 CAGTAATTTCCAAAGAGTGTGGG + Intergenic
1141937737 16:87252955-87252977 CACTGATTGCCACTGAGTCTGGG + Intronic
1141974636 16:87507398-87507420 GGCTGCTTTCCACAGGGTGGTGG + Intergenic
1203090303 16_KI270728v1_random:1208822-1208844 CGCTGGTCTCCAGAGAGTGTCGG - Intergenic
1142749957 17:1981450-1981472 CTCTGCTTTCCAGAGACTTTAGG + Intronic
1142893591 17:2960540-2960562 CCCTGCTGTCCACAGAGTGTGGG + Intronic
1144569136 17:16384744-16384766 CATTCCTTTCCGCAGAGTATAGG - Intergenic
1146919399 17:36700226-36700248 CATTGCCTTCCACAAAGTGGAGG + Intergenic
1147148444 17:38499283-38499305 CGCTGGTCTCCAGAGAGTGTCGG - Intronic
1148612886 17:48976464-48976486 CATTTCTTTCCCCAGAGTGAGGG + Intergenic
1149188119 17:54026259-54026281 CACTGCTAGTCACAGAATGTAGG - Intergenic
1150964308 17:69950353-69950375 CAGTGCTTTCCAGAGAGTAGGGG + Intergenic
1151823636 17:76511466-76511488 CACTGGCTTCCCCGGAGTGTTGG + Intergenic
1152241150 17:79161896-79161918 CCCTGGTCCCCACAGAGTGTGGG - Intronic
1156618413 18:38817629-38817651 TACTGCTTTACATTGAGTGTAGG - Intergenic
1157513141 18:48292910-48292932 CAGTGCTTGCCACCGAGTGAGGG - Intronic
1158613245 18:58962381-58962403 AAATGCTTTCCACAGAGACTTGG - Intronic
1160520325 18:79504674-79504696 CACTGCTTTTCACAAAGGGGAGG - Intronic
1161517611 19:4705031-4705053 CACTGCTTTCCACAGAGTGTAGG - Intronic
925878989 2:8334967-8334989 CACTTCTCACCACTGAGTGTTGG - Intergenic
929629624 2:43446027-43446049 CACTCCTTTACACAGTGAGTTGG + Intronic
930555933 2:52895397-52895419 CTCTGCTTTCTACACAGTGCCGG - Intergenic
932011683 2:67984166-67984188 TACTGCTTTCCAAAAAGTGATGG - Intergenic
934603648 2:95678282-95678304 CAGTGCTATCCATAAAGTGTTGG + Intergenic
935193732 2:100798656-100798678 CAGTGTTTTGCACAAAGTGTGGG + Intergenic
936171883 2:110184152-110184174 TACTGCTTTCCAAAGTATGTGGG + Intronic
937152099 2:119693013-119693035 CACTGCTTTCCACAGGGACCTGG - Intergenic
937506405 2:122542219-122542241 CTCTACTTTCCACAGTTTGTAGG + Intergenic
939477441 2:142704095-142704117 GACTGCTTTCTGAAGAGTGTTGG + Intergenic
939876867 2:147587441-147587463 CACTGCCTTCCAAGGAGAGTAGG + Intergenic
940969535 2:159880719-159880741 CAATTTTTTCCACAGAGGGTGGG + Intronic
942468625 2:176235583-176235605 CACTGGCTTCCACAGAGTGTTGG - Intergenic
942581740 2:177426419-177426441 CACTACTTTCAACATAGTATTGG - Intronic
944006548 2:194915015-194915037 CAGTGTTTTCCACAGAGTAAAGG + Intergenic
945256921 2:207810763-207810785 CTCTGTTTTCCAAAGAGTTTTGG - Intergenic
946797523 2:223371841-223371863 CAAGGCTTTACACAGATTGTTGG + Intergenic
947530791 2:230907551-230907573 CCCTTCTTTCCACAGTGTTTTGG + Exonic
947784894 2:232808116-232808138 CACTGCTCTCCACAAACTATAGG - Intronic
1172921660 20:38488499-38488521 CACAGCTATCCAGAGAGCGTTGG + Exonic
1173326944 20:42042519-42042541 CTCTGCTGTCCACAGATTGCTGG + Intergenic
1173590561 20:44221614-44221636 CACCCCTTTCCACACAGTCTTGG - Intergenic
1174163342 20:48567309-48567331 AACTGGCTTCCCCAGAGTGTTGG - Intergenic
1178856844 21:36257432-36257454 CACTGCTTCCTCCAGGGTGTGGG + Intronic
1180153726 21:45966842-45966864 CACTCCTTTCCCCAGGGTCTAGG - Intergenic
1183469901 22:37999631-37999653 CTCTGCGTCCCACAGAGTCTAGG - Intronic
1184876565 22:47279566-47279588 CACTGCAATCCACAGCGTTTGGG - Intergenic
949759319 3:7451746-7451768 CACAGCTTTCAACACAGTGTGGG + Intronic
949768640 3:7554048-7554070 CATAGCTTTGCACAGAGGGTGGG - Intronic
952014812 3:28943589-28943611 CACTGCTTTCCACTGGCAGTTGG + Intergenic
952786591 3:37161532-37161554 TAGTGCTTTCCACAAAGTCTCGG + Intronic
953103304 3:39851460-39851482 CACTTTTTTCCTCAGGGTGTGGG + Intronic
954333220 3:49901822-49901844 CTCTGCTTTCCAAAGGGGGTGGG - Intronic
954715778 3:52526071-52526093 AGCTGCTTTCCACTGTGTGTTGG - Intronic
955713944 3:61809109-61809131 CACTGCCTTCCACATAGTGAAGG + Intronic
956451846 3:69382647-69382669 CACTGATTGGCACAGAGTATGGG - Intronic
957763869 3:84595115-84595137 CACTGCCTACTACAGAGAGTAGG + Intergenic
961307962 3:125972495-125972517 CCCTTCTTTCCACCGAGAGTGGG - Intronic
963348758 3:144127430-144127452 CTCTGCTTTCCAGAGTGTATTGG + Intergenic
963993974 3:151685251-151685273 CATTCCTTTCCCCAGGGTGTAGG - Intergenic
964506685 3:157407321-157407343 CATTGCTTTCCATAAAGGGTAGG - Intronic
964784610 3:160381553-160381575 CACTGGTTTCCAAAAAGTTTGGG - Exonic
967779143 3:193417645-193417667 CACTGCTTTCAACAGTGTGCTGG + Intronic
968441103 4:625022-625044 CTCTGCATCCCTCAGAGTGTGGG + Intergenic
968443787 4:637960-637982 CACTGTTCTCCACGGGGTGTGGG - Intronic
970239399 4:13992686-13992708 GGCTGCTTTGCACACAGTGTTGG - Intergenic
971550611 4:27951270-27951292 AACTGCTCTCCACAGAGGCTGGG - Intergenic
974813611 4:66977699-66977721 CCCTGCTTTCCACTGGGTGGGGG - Intergenic
976600199 4:86931358-86931380 CACCGCTTTCCCCGGAGTCTGGG + Intronic
978529063 4:109696033-109696055 CACTGGTTTCCAAATAGTGTTGG - Intronic
982035347 4:151340651-151340673 CACTCTTTTCCCCAGATTGTTGG - Intergenic
983545948 4:168964480-168964502 CACTGCTTACCAAAGAGAGAAGG - Intronic
984354823 4:178644377-178644399 CAGTTCTTTCTACTGAGTGTGGG + Intergenic
984860875 4:184236834-184236856 CACTCCTCTCCACTGAGGGTGGG + Intergenic
986480773 5:8184724-8184746 CACTTCTTTCCACATAATATGGG - Intergenic
988695564 5:33618949-33618971 CACTCCTTTCCAAAGAGTATTGG + Intronic
991111727 5:62907739-62907761 GACTTCTTTCCAAAGAGTATGGG - Intergenic
994273554 5:97809381-97809403 AACAGCTTTCCACAGAGAGGGGG + Intergenic
994367545 5:98932563-98932585 CACTGCTGTCCAAATACTGTTGG + Intergenic
997401391 5:133605886-133605908 CTCTGCCTTCTTCAGAGTGTGGG - Intronic
997637955 5:135428569-135428591 CATTGCTTTCCAGAGAATTTAGG - Intergenic
998203262 5:140142170-140142192 CACTGCTTTGCACAAAGTAAGGG - Intergenic
1002921822 6:1578398-1578420 CAGTCCTTTCCACAGAGGCTAGG + Intergenic
1003536197 6:6977804-6977826 AACTGGTTTCCACAGAGGCTGGG - Intergenic
1004213179 6:13673646-13673668 CACTGCTTCACACATAGTGCAGG - Intronic
1004285007 6:14313597-14313619 CAGTTCTTTCCTCAGAGAGTGGG + Intergenic
1006394394 6:33777675-33777697 CACGGCTTTCCAGAGATAGTTGG - Intronic
1007325621 6:41057351-41057373 ACCTGCCTTCCACAGAGGGTTGG + Intronic
1008228666 6:48955856-48955878 CAATAATTTCCATAGAGTGTTGG - Intergenic
1010595714 6:77761251-77761273 TACAGCTTTCCACAAAGTGCTGG - Exonic
1011536065 6:88377529-88377551 CACTGCCTTGCACAGATTTTAGG + Intergenic
1016479413 6:144466121-144466143 CATTTCTTTCCACAGTGTGGGGG - Intronic
1017218107 6:151933993-151934015 CACTGCTTTCCATAGAGCAGAGG - Intronic
1018963125 6:168462819-168462841 CACAGCTCTACACAGAGAGTTGG - Intronic
1022077465 7:26986370-26986392 CACTGCTTTCTGCAAAGTCTAGG - Intronic
1023042367 7:36182950-36182972 TACTGCTTTCCACAAAGGGAAGG - Intronic
1024656480 7:51455106-51455128 CAGAGCTTTAAACAGAGTGTGGG + Intergenic
1025028314 7:55535963-55535985 CCTTGCTTGGCACAGAGTGTGGG - Intronic
1026376282 7:69754199-69754221 CACCTCTTCCCACACAGTGTTGG - Intronic
1028056739 7:86254742-86254764 CACTCTTTTCAACATAGTGTTGG + Intergenic
1031605711 7:123764512-123764534 CACTGCCTAGCACAGAGTCTAGG + Intergenic
1032257825 7:130311263-130311285 CACTGCTTGCCAAGGACTGTGGG + Intronic
1033716663 7:144009686-144009708 TACTGGTTTCCACATGGTGTTGG + Intergenic
1034752452 7:153583543-153583565 CAGTGCTTTGCCCAGAGTATGGG - Intergenic
1037198352 8:16219946-16219968 CACTCCTTTCAACACAGTATCGG - Intronic
1038656097 8:29453301-29453323 CACTCCTATCAACATAGTGTTGG + Intergenic
1040861171 8:52000698-52000720 CACTCCTTTCCACACATTTTTGG + Intergenic
1041131919 8:54710426-54710448 CACTGCTGTCTACAGACGGTGGG - Intergenic
1042041615 8:64597657-64597679 GACTGCTTTACCTAGAGTGTTGG + Intronic
1042169068 8:65974872-65974894 TTCTGCCTTCCACAAAGTGTAGG - Intergenic
1042573177 8:70189510-70189532 CAGTGTTTTCTCCAGAGTGTGGG - Intronic
1042624895 8:70747332-70747354 AACTGCTTTCCACAGGGGATTGG + Intronic
1044443682 8:92249131-92249153 CATTGGTTTCCTCAGAGTGTTGG + Intergenic
1045162446 8:99563604-99563626 AACTTGTTTCCACAGAGTATGGG + Intronic
1045556314 8:103218072-103218094 AACTGCTTTCCAAAGGGTGATGG + Intronic
1045977823 8:108149535-108149557 CACTGTTTTCCACTGAGTATTGG - Intergenic
1046788797 8:118297955-118297977 CACTGCTTTCCACTGCATTTAGG - Intronic
1047513150 8:125530730-125530752 CACTGATTTCCAAAGAGTCTAGG + Intergenic
1049149216 8:141023541-141023563 CACTGCCTCCCACAGTGTCTGGG + Intergenic
1052731955 9:32297135-32297157 CAGTGCTTTCCAAAAAGTCTTGG - Intergenic
1052889926 9:33689292-33689314 CACTGCTTCTCAAAGAGTTTTGG + Intergenic
1055104437 9:72497861-72497883 CAGCGCTTTACACATAGTGTAGG + Intergenic
1056738111 9:89226853-89226875 TACTGCTTTTCATCGAGTGTTGG + Intergenic
1058824792 9:108765586-108765608 CACTGCCTTCCCCACATTGTAGG - Intergenic
1059084814 9:111288636-111288658 CACTGCTGTCCACAATGTTTCGG + Intergenic
1059169869 9:112114904-112114926 TACTGGTCTCCACAGAGGGTGGG - Intronic
1059488223 9:114643870-114643892 CACTGCTTTTCACAAAATATGGG - Exonic
1185877149 X:3711192-3711214 CCCTGCTGTCCAATGAGTGTGGG + Intronic
1185938621 X:4288064-4288086 CTCTGGTTTGCACAGACTGTGGG + Intergenic
1186393305 X:9182716-9182738 CACTGCATTTAACAGAATGTGGG + Intergenic
1187394322 X:18906684-18906706 CACAGCCTTCCTCAGAGTGGAGG - Intronic
1189319988 X:40082165-40082187 CACATCTTTTCACAGAGGGTGGG - Intronic
1189627005 X:42909341-42909363 CACTCCTATTCACACAGTGTGGG - Intergenic
1192661953 X:73050885-73050907 CACTGCTTTCAACATAGTCCTGG + Intergenic
1192851142 X:74957357-74957379 CACTCCATTCAACATAGTGTTGG + Intergenic
1194275707 X:91878469-91878491 CCTTGGTTTACACAGAGTGTTGG + Exonic
1195958248 X:110357793-110357815 CTCTGCTTCCCACACAATGTGGG - Intronic
1196548235 X:116990887-116990909 ATCTGATTTCCTCAGAGTGTTGG - Intergenic
1197682987 X:129406324-129406346 CACTCCTTTCAACATAGTGTTGG + Intergenic
1197720972 X:129744442-129744464 TACTCCATTCCACAGAGTATGGG - Intronic
1199250772 X:145659463-145659485 TAGTGGTTTCCACATAGTGTTGG + Intergenic
1200000523 X:153057489-153057511 CACTGCTGCCCCCAGAGTCTGGG - Exonic
1200592952 Y:5099903-5099925 CCTTGGTTTACACAGAGTGTTGG + Exonic