ID: 1161517613

View in Genome Browser
Species Human (GRCh38)
Location 19:4705049-4705071
Sequence CAGTGTAAACACAAGGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 18708
Summary {0: 1, 1: 0, 2: 36, 3: 1357, 4: 17314}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161517610_1161517613 -4 Left 1161517610 19:4705030-4705052 CCCTACACTCTGTGGAAAGCAGT 0: 1
1: 0
2: 1
3: 8
4: 159
Right 1161517613 19:4705049-4705071 CAGTGTAAACACAAGGACACTGG 0: 1
1: 0
2: 36
3: 1357
4: 17314
1161517611_1161517613 -5 Left 1161517611 19:4705031-4705053 CCTACACTCTGTGGAAAGCAGTG 0: 1
1: 0
2: 2
3: 14
4: 186
Right 1161517613 19:4705049-4705071 CAGTGTAAACACAAGGACACTGG 0: 1
1: 0
2: 36
3: 1357
4: 17314
1161517609_1161517613 -3 Left 1161517609 19:4705029-4705051 CCCCTACACTCTGTGGAAAGCAG 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1161517613 19:4705049-4705071 CAGTGTAAACACAAGGACACTGG 0: 1
1: 0
2: 36
3: 1357
4: 17314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161517613 Original CRISPR CAGTGTAAACACAAGGACAC TGG Intronic
Too many off-targets to display for this crispr