ID: 1161518793

View in Genome Browser
Species Human (GRCh38)
Location 19:4712066-4712088
Sequence TCCCGTTGGGGTTGCTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161518793_1161518799 -1 Left 1161518793 19:4712066-4712088 CCAGGACAGCAACCCCAACGGGA No data
Right 1161518799 19:4712088-4712110 AGCAAGTGGCCCAAGACTGTGGG No data
1161518793_1161518803 20 Left 1161518793 19:4712066-4712088 CCAGGACAGCAACCCCAACGGGA No data
Right 1161518803 19:4712109-4712131 GGCGCCACAGGATAAAAAAGAGG No data
1161518793_1161518801 8 Left 1161518793 19:4712066-4712088 CCAGGACAGCAACCCCAACGGGA No data
Right 1161518801 19:4712097-4712119 CCCAAGACTGTGGGCGCCACAGG No data
1161518793_1161518805 26 Left 1161518793 19:4712066-4712088 CCAGGACAGCAACCCCAACGGGA No data
Right 1161518805 19:4712115-4712137 ACAGGATAAAAAAGAGGCAACGG No data
1161518793_1161518798 -2 Left 1161518793 19:4712066-4712088 CCAGGACAGCAACCCCAACGGGA No data
Right 1161518798 19:4712087-4712109 GAGCAAGTGGCCCAAGACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161518793 Original CRISPR TCCCGTTGGGGTTGCTGTCC TGG (reversed) Intronic