ID: 1161518799

View in Genome Browser
Species Human (GRCh38)
Location 19:4712088-4712110
Sequence AGCAAGTGGCCCAAGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161518785_1161518799 27 Left 1161518785 19:4712038-4712060 CCACAGAAAACTCCTCCAAACGC No data
Right 1161518799 19:4712088-4712110 AGCAAGTGGCCCAAGACTGTGGG No data
1161518789_1161518799 5 Left 1161518789 19:4712060-4712082 CCCTGACCAGGACAGCAACCCCA No data
Right 1161518799 19:4712088-4712110 AGCAAGTGGCCCAAGACTGTGGG No data
1161518793_1161518799 -1 Left 1161518793 19:4712066-4712088 CCAGGACAGCAACCCCAACGGGA No data
Right 1161518799 19:4712088-4712110 AGCAAGTGGCCCAAGACTGTGGG No data
1161518787_1161518799 15 Left 1161518787 19:4712050-4712072 CCTCCAAACGCCCTGACCAGGAC No data
Right 1161518799 19:4712088-4712110 AGCAAGTGGCCCAAGACTGTGGG No data
1161518788_1161518799 12 Left 1161518788 19:4712053-4712075 CCAAACGCCCTGACCAGGACAGC No data
Right 1161518799 19:4712088-4712110 AGCAAGTGGCCCAAGACTGTGGG No data
1161518790_1161518799 4 Left 1161518790 19:4712061-4712083 CCTGACCAGGACAGCAACCCCAA No data
Right 1161518799 19:4712088-4712110 AGCAAGTGGCCCAAGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161518799 Original CRISPR AGCAAGTGGCCCAAGACTGT GGG Intronic