ID: 1161518803

View in Genome Browser
Species Human (GRCh38)
Location 19:4712109-4712131
Sequence GGCGCCACAGGATAAAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161518797_1161518803 6 Left 1161518797 19:4712080-4712102 CCAACGGGAGCAAGTGGCCCAAG No data
Right 1161518803 19:4712109-4712131 GGCGCCACAGGATAAAAAAGAGG No data
1161518793_1161518803 20 Left 1161518793 19:4712066-4712088 CCAGGACAGCAACCCCAACGGGA No data
Right 1161518803 19:4712109-4712131 GGCGCCACAGGATAAAAAAGAGG No data
1161518790_1161518803 25 Left 1161518790 19:4712061-4712083 CCTGACCAGGACAGCAACCCCAA No data
Right 1161518803 19:4712109-4712131 GGCGCCACAGGATAAAAAAGAGG No data
1161518796_1161518803 7 Left 1161518796 19:4712079-4712101 CCCAACGGGAGCAAGTGGCCCAA No data
Right 1161518803 19:4712109-4712131 GGCGCCACAGGATAAAAAAGAGG No data
1161518789_1161518803 26 Left 1161518789 19:4712060-4712082 CCCTGACCAGGACAGCAACCCCA No data
Right 1161518803 19:4712109-4712131 GGCGCCACAGGATAAAAAAGAGG No data
1161518795_1161518803 8 Left 1161518795 19:4712078-4712100 CCCCAACGGGAGCAAGTGGCCCA No data
Right 1161518803 19:4712109-4712131 GGCGCCACAGGATAAAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161518803 Original CRISPR GGCGCCACAGGATAAAAAAG AGG Intronic