ID: 1161518805

View in Genome Browser
Species Human (GRCh38)
Location 19:4712115-4712137
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 748
Summary {0: 1, 1: 0, 2: 1, 3: 73, 4: 673}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161518802_1161518805 -6 Left 1161518802 19:4712098-4712120 CCAAGACTGTGGGCGCCACAGGA No data
Right 1161518805 19:4712115-4712137 ACAGGATAAAAAAGAGGCAACGG 0: 1
1: 0
2: 1
3: 73
4: 673
1161518793_1161518805 26 Left 1161518793 19:4712066-4712088 CCAGGACAGCAACCCCAACGGGA No data
Right 1161518805 19:4712115-4712137 ACAGGATAAAAAAGAGGCAACGG 0: 1
1: 0
2: 1
3: 73
4: 673
1161518797_1161518805 12 Left 1161518797 19:4712080-4712102 CCAACGGGAGCAAGTGGCCCAAG No data
Right 1161518805 19:4712115-4712137 ACAGGATAAAAAAGAGGCAACGG 0: 1
1: 0
2: 1
3: 73
4: 673
1161518795_1161518805 14 Left 1161518795 19:4712078-4712100 CCCCAACGGGAGCAAGTGGCCCA No data
Right 1161518805 19:4712115-4712137 ACAGGATAAAAAAGAGGCAACGG 0: 1
1: 0
2: 1
3: 73
4: 673
1161518800_1161518805 -5 Left 1161518800 19:4712097-4712119 CCCAAGACTGTGGGCGCCACAGG No data
Right 1161518805 19:4712115-4712137 ACAGGATAAAAAAGAGGCAACGG 0: 1
1: 0
2: 1
3: 73
4: 673
1161518796_1161518805 13 Left 1161518796 19:4712079-4712101 CCCAACGGGAGCAAGTGGCCCAA No data
Right 1161518805 19:4712115-4712137 ACAGGATAAAAAAGAGGCAACGG 0: 1
1: 0
2: 1
3: 73
4: 673

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type