ID: 1161519904

View in Genome Browser
Species Human (GRCh38)
Location 19:4718145-4718167
Sequence TGGCAGGATCGCTGGAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99077
Summary {0: 1, 1: 160, 2: 4394, 3: 29027, 4: 65495}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161519904_1161519912 8 Left 1161519904 19:4718145-4718167 CCTGGGCTCCAGCGATCCTGCCA 0: 1
1: 160
2: 4394
3: 29027
4: 65495
Right 1161519912 19:4718176-4718198 TAGCAAATAGCTGGGATGAGAGG 0: 1
1: 0
2: 5
3: 136
4: 5462
1161519904_1161519913 9 Left 1161519904 19:4718145-4718167 CCTGGGCTCCAGCGATCCTGCCA 0: 1
1: 160
2: 4394
3: 29027
4: 65495
Right 1161519913 19:4718177-4718199 AGCAAATAGCTGGGATGAGAGGG 0: 1
1: 0
2: 1
3: 20
4: 384
1161519904_1161519911 0 Left 1161519904 19:4718145-4718167 CCTGGGCTCCAGCGATCCTGCCA 0: 1
1: 160
2: 4394
3: 29027
4: 65495
Right 1161519911 19:4718168-4718190 CCTCGGTCTAGCAAATAGCTGGG 0: 1
1: 0
2: 6
3: 662
4: 20255
1161519904_1161519914 10 Left 1161519904 19:4718145-4718167 CCTGGGCTCCAGCGATCCTGCCA 0: 1
1: 160
2: 4394
3: 29027
4: 65495
Right 1161519914 19:4718178-4718200 GCAAATAGCTGGGATGAGAGGGG 0: 1
1: 0
2: 1
3: 68
4: 1104
1161519904_1161519909 -1 Left 1161519904 19:4718145-4718167 CCTGGGCTCCAGCGATCCTGCCA 0: 1
1: 160
2: 4394
3: 29027
4: 65495
Right 1161519909 19:4718167-4718189 ACCTCGGTCTAGCAAATAGCTGG 0: 1
1: 0
2: 1
3: 177
4: 5263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161519904 Original CRISPR TGGCAGGATCGCTGGAGCCC AGG (reversed) Intronic
Too many off-targets to display for this crispr