ID: 1161521246

View in Genome Browser
Species Human (GRCh38)
Location 19:4724529-4724551
Sequence ATGTCTAAAAGGCAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 390}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161521240_1161521246 14 Left 1161521240 19:4724492-4724514 CCATCAATCACGGAAAATTTTTT 0: 1
1: 0
2: 0
3: 32
4: 499
Right 1161521246 19:4724529-4724551 ATGTCTAAAAGGCAGGAGGAAGG 0: 1
1: 0
2: 2
3: 29
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161521246 Original CRISPR ATGTCTAAAAGGCAGGAGGA AGG Intronic
900194938 1:1371331-1371353 ATGTCTCACAGGCAGGGGCAGGG + Intergenic
900579911 1:3403768-3403790 AATCCTCAAAGGCAGGAGGAGGG - Intronic
901123191 1:6911385-6911407 ATTACTCACAGGCAGGAGGATGG - Intronic
901286835 1:8087107-8087129 ATGGGGAAAAGGCAGGAGGGAGG - Intergenic
902620417 1:17647525-17647547 ATGAATAAAAGGAAGGAGGGAGG - Intronic
905110864 1:35593513-35593535 AAGCCTCAAAGGCAGGAGGGTGG - Intronic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
905340877 1:37276505-37276527 ATGACTGCCAGGCAGGAGGAAGG + Intergenic
905882960 1:41476447-41476469 TTATGGAAAAGGCAGGAGGAGGG + Intergenic
905915679 1:41682718-41682740 AGGTCTCAGAGGCAGCAGGAGGG - Intronic
905957709 1:42012768-42012790 CTGTCTACAAGCCAGGAAGAGGG + Intronic
905965465 1:42090769-42090791 ATGGCATAAAGGCAGGAGGGTGG + Intergenic
906151511 1:43590546-43590568 ATGTGTAATAGGCAGGGGAAGGG - Intronic
907806483 1:57825528-57825550 AGGTGTTAAGGGCAGGAGGAAGG + Intronic
908027551 1:59968684-59968706 ATGTGTAAAAGGCCCGAGGGGGG + Intergenic
908027921 1:59970992-59971014 ATTTGCATAAGGCAGGAGGATGG + Intergenic
908832044 1:68189128-68189150 GTGACTAACAGGCAGGAGCAGGG - Intronic
909591497 1:77353937-77353959 ATGTACAAAAGGCTGCAGGAGGG + Intronic
909641808 1:77876596-77876618 ATAACTAAAAGGAAGGAGAAAGG - Exonic
910409656 1:86926874-86926896 ACTTCTATAAGGAAGGAGGAAGG - Intronic
912410595 1:109478305-109478327 GTGTAGAACAGGCAGGAGGAGGG - Intronic
912937597 1:114017429-114017451 GTGTCTAAATTGCTGGAGGAAGG + Intergenic
914429203 1:147604629-147604651 AGGTCAAAAAGGGAGAAGGAAGG - Intronic
915009043 1:152667330-152667352 ATCTCTCAAGGGCAGGAAGAGGG + Intergenic
915010302 1:152679117-152679139 ATCTCTCAAGGGCAGGAGGAGGG + Intergenic
916024651 1:160823279-160823301 ATGCTTGAAAGGAAGGAGGAAGG + Intronic
916443355 1:164848937-164848959 ATGACTAAAAGGCACTAGAAAGG + Exonic
917509605 1:175659321-175659343 ATGTATAAAAGCAAAGAGGAAGG + Intronic
918345540 1:183604322-183604344 ATGTCAGAGAGGCAGGAGGAAGG + Intergenic
922191536 1:223323174-223323196 GTGACAAAAAGGAAGGAGGAAGG + Intronic
923256364 1:232224853-232224875 ATAAGTAAAAGGGAGGAGGATGG - Intergenic
923480243 1:234377016-234377038 CTGTCTACAAGCCAGGATGAGGG - Intronic
924043924 1:240009421-240009443 ATCTCTGAAAGGCAGAGGGAAGG + Intergenic
924193622 1:241581674-241581696 ATGTCAAAATGCCAGGGGGATGG - Intronic
924542736 1:244996398-244996420 ATGTGTGAAAGCCAGGAGGCGGG + Intronic
1063493302 10:6484960-6484982 CTTTGTAAAAGGCAGGAGGTGGG - Intronic
1063815726 10:9769060-9769082 CTTTCTCAAAGGCAGGAGCAAGG + Intergenic
1065464204 10:26001679-26001701 AGGTCTTAAAAGAAGGAGGAGGG + Intronic
1065803413 10:29373076-29373098 CTGTCTACAAGCCAGGAAGAGGG - Intergenic
1066226843 10:33392148-33392170 ATATCAGCAAGGCAGGAGGAAGG + Intergenic
1066450295 10:35522332-35522354 ATCTCGCAAAGGCAGGTGGATGG - Intronic
1067839786 10:49666404-49666426 AAGTCTAAAGGGCAGAGGGAGGG + Intergenic
1070004949 10:72414847-72414869 CTGATTAAAAGGCAGGAAGAGGG - Intronic
1070053195 10:72909086-72909108 AACTCCAAAAGGTAGGAGGAGGG - Intronic
1070481164 10:76884175-76884197 ATGTCTGAAAGGCAGCTGGCAGG + Intronic
1071439731 10:85679660-85679682 ATGTCTTACTGGCAGGAGAATGG + Intronic
1072252155 10:93590187-93590209 ATGTTTAATAGGCAGAAGAAAGG + Intronic
1073814979 10:107196518-107196540 CTGTCTACAAGGCAGGAAGCAGG + Intergenic
1074160830 10:110835135-110835157 ATGCTTAAAAGGCAGAGGGAGGG - Intronic
1074444866 10:113513387-113513409 AAGTCTGAAAGGCAGAAGGAAGG - Intergenic
1074502568 10:114040291-114040313 ATGTACAAAAGGAAGGAGTATGG + Intergenic
1074956117 10:118391721-118391743 ATCTCTACAAGGCAGGAAGAAGG + Intergenic
1075587926 10:123670806-123670828 ATGTCTTGCAGGCAGGATGAGGG + Intronic
1077283334 11:1755166-1755188 AGGCCCAGAAGGCAGGAGGAGGG + Intronic
1079386240 11:19982625-19982647 ATGTCATAAAGGGAGGAGCAGGG + Intronic
1081012025 11:37825453-37825475 ATGTCTAAAAGGTTTGTGGAAGG - Intergenic
1081590877 11:44422263-44422285 ATGTCAAAAAGGGAGGAGGAGGG + Intergenic
1081776330 11:45678276-45678298 GTGTCAAAACGGCAGGTGGAGGG - Intergenic
1083051445 11:59780352-59780374 CTGTCTACAAGCCAGGAAGAGGG + Intronic
1083476619 11:62919610-62919632 ATGCCTACAAGGATGGAGGAGGG - Intronic
1083511096 11:63209989-63210011 ATGGGAAAAAAGCAGGAGGAAGG + Intronic
1084975915 11:72798218-72798240 ATGTCCTAGAGGCAGGAAGAAGG - Intergenic
1085179415 11:74521020-74521042 ATGGCCAAGAGGCAGGATGAGGG + Intronic
1085226177 11:74923201-74923223 ATGTATAGAAGCCAGGAGGCAGG + Intronic
1085865457 11:80285863-80285885 ATGCCTAAAATGCAGAAGGCTGG - Intergenic
1086176147 11:83893427-83893449 ATATCTGAGAGGCAGGAAGAAGG - Intronic
1086331124 11:85755431-85755453 GTGACTAAATGGCAGGAAGAAGG - Intronic
1086536518 11:87853419-87853441 CTATCTGAAAGCCAGGAGGAAGG + Intergenic
1086858803 11:91899919-91899941 ATGACTAGAAGGCAGGAGAGGGG - Intergenic
1087147671 11:94828021-94828043 AAGTCTAAAAGCCAGGAGAGTGG - Intronic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088832006 11:113545010-113545032 ATTACTATAGGGCAGGAGGAAGG - Intergenic
1088833100 11:113554892-113554914 AAGTCTAATAGGCAGAAGAAAGG - Intergenic
1088928866 11:114328935-114328957 ATATCTAAGAGGCAGGAAAAGGG - Intergenic
1090099988 11:123784202-123784224 CTGTCTAATACCCAGGAGGAAGG + Intergenic
1090972496 11:131655409-131655431 TTGCCAAAAAGGAAGGAGGAAGG - Intronic
1091349772 11:134883718-134883740 TTTTTTAAAAGGCAGGAGAAGGG + Intergenic
1093671218 12:21878395-21878417 ATGTGTAGAAGGCATGAGGTTGG - Intronic
1096127818 12:49132573-49132595 TTGTCTAAAATGAAGGATGAAGG - Intergenic
1096445147 12:51683097-51683119 ATGTATGAGAGGCAGCAGGAGGG - Intronic
1096740732 12:53692216-53692238 ATGACTAAAAGGAAGGGGGTGGG + Intergenic
1097724397 12:63058334-63058356 ATGTCTAAAAGGCTGGTGGGAGG + Intergenic
1098164233 12:67677219-67677241 CTGTCTGAAAGCCAGGAGGAGGG - Intergenic
1098467113 12:70800233-70800255 ATGTCTAAAATGCAGTGGGTAGG - Intronic
1099529807 12:83763815-83763837 ATATCTAGAAAGCAGCAGGAGGG - Intergenic
1099676277 12:85764783-85764805 AAGAATAAAAGGAAGGAGGAAGG + Intergenic
1101021372 12:100557600-100557622 AACTCCAAAAGGCAGGAGGGTGG - Intronic
1101145862 12:101839851-101839873 ATTTTTAAAAGGACGGAGGAAGG + Intergenic
1101225692 12:102686146-102686168 AAGACTAAAAGGGAGGAGAATGG + Intergenic
1101655411 12:106715979-106716001 ATGTCTGAGAAGCAGGTGGATGG + Intronic
1101954339 12:109199925-109199947 ATGGCGTGAAGGCAGGAGGATGG + Intronic
1102206683 12:111095845-111095867 ATGTCTCAAAGCCAGAATGAAGG + Intronic
1102760359 12:115379864-115379886 CTGTCTAAAGGGCAGGAAGGTGG - Intergenic
1104114094 12:125732516-125732538 ATGTCCTAAAGACAGGAGGCAGG + Intergenic
1105929043 13:25034609-25034631 GATTCCAAAAGGCAGGAGGAAGG - Intergenic
1105950915 13:25228895-25228917 ATGTTTAAAAGGGAAGAAGATGG + Intergenic
1107204691 13:37769592-37769614 TTGTCTAAAAGTCAGGAAAAAGG - Intronic
1107521359 13:41185386-41185408 ATTACTAAAAGGAAGGAGAATGG - Intergenic
1107668091 13:42713611-42713633 ATATCTCAAGGGCAGGATGAAGG + Intergenic
1108179545 13:47827241-47827263 ATCTCCAACAAGCAGGAGGAAGG - Intergenic
1108781931 13:53847105-53847127 ATGGCTCAAAGGCAGCAGTAGGG - Intergenic
1108809208 13:54200646-54200668 ATGGCTAAAAGGAAAGAGGCAGG - Intergenic
1109043944 13:57382588-57382610 CTGTCTACAAGCCAGGAAGAAGG + Intergenic
1109367161 13:61370383-61370405 ATCTGCAAAAGGCAGAAGGAAGG - Intergenic
1109742356 13:66570931-66570953 ATGCATAAAAGGGAGGAGGGAGG + Intronic
1109999704 13:70179491-70179513 TTGTGTACAAGGCAAGAGGATGG + Intergenic
1110774541 13:79393245-79393267 AAGTCATAAAGGCAGGAGGTAGG + Intronic
1112029623 13:95445189-95445211 AGACCTAAAAAGCAGGAGGAAGG + Intronic
1112705040 13:102059187-102059209 ATGTCTAGGAGGCAAGTGGAAGG + Intronic
1112795394 13:103051026-103051048 ATGTCTGCAAGCCACGAGGAAGG + Intronic
1114741524 14:25103278-25103300 ATATATATAAGGAAGGAGGAAGG + Intergenic
1115456844 14:33613643-33613665 ATGGCTAAAAGGGAGAAGGCTGG - Intronic
1117122556 14:52584003-52584025 GTGACTAAAAGTCAGGATGAGGG - Intronic
1118012847 14:61627746-61627768 AGGCCTAAGAGGCAAGAGGATGG - Intronic
1118609627 14:67529918-67529940 AGGTCCTGAAGGCAGGAGGAGGG + Intronic
1118738458 14:68719979-68720001 GTGACTCAGAGGCAGGAGGAGGG - Intronic
1118911613 14:70066487-70066509 GGGTCTTAAAGGCAGAAGGAAGG - Intronic
1119459838 14:74791498-74791520 ATGTGTAAAAGCCAGAAGAAAGG - Intronic
1120452093 14:84681215-84681237 ATGTATAAAGGACAGAAGGAAGG + Intergenic
1120855538 14:89208873-89208895 ATGTTTAAGAGACAGGTGGAGGG - Intronic
1121246040 14:92461493-92461515 CTGTCTACAAGTCAGGAAGAGGG - Intronic
1121433224 14:93902105-93902127 ATGTCAAGAAGGGAAGAGGAGGG - Intergenic
1121695235 14:95907126-95907148 GTGGCAAAAAGGAAGGAGGAAGG - Intergenic
1122773036 14:104105631-104105653 GGGTCTATAAGGCAGGAGGCAGG + Intronic
1124876852 15:33602955-33602977 ATCTCTAAAAGCCAGGAGTCTGG - Intronic
1125190429 15:36986399-36986421 AAGACTGGAAGGCAGGAGGAGGG + Intronic
1125874261 15:43130290-43130312 AGATATAAAAGGCAGGGGGAAGG - Intronic
1127281317 15:57496053-57496075 ATGAGTGAAAGACAGGAGGAGGG + Intronic
1127854745 15:62945216-62945238 AAGTCTGAAGGGCAGGAGGCTGG + Intergenic
1128981859 15:72194021-72194043 ATGTGGGAAAGGAAGGAGGAGGG - Intronic
1130334651 15:82948663-82948685 AAGTCTGAAAGGAAAGAGGAAGG + Intronic
1130433831 15:83875831-83875853 ATGTGTAAGACACAGGAGGAAGG + Intronic
1130907839 15:88252647-88252669 ACGTCACAAAGGCAGGAGGGTGG - Intronic
1131421240 15:92307314-92307336 TTGTCTGCAAGCCAGGAGGAAGG - Intergenic
1131978227 15:97967639-97967661 ATATATAAAAGTCAGGTGGAAGG - Intronic
1133796844 16:9053157-9053179 ATGAGTAAAATGCAGGAGCACGG + Intergenic
1134995106 16:18733618-18733640 ATGTCTTAGAGGTAGGAGGCAGG + Intergenic
1135742041 16:24984270-24984292 CTGTCTAGCAGGGAGGAGGACGG - Intronic
1135988625 16:27203421-27203443 CTGTTTAAAAGGCCGGGGGATGG - Intergenic
1136388006 16:29942184-29942206 ATGTGTACAAGGCAGAAAGAAGG + Intronic
1137378903 16:47979490-47979512 TTGTAAAAGAGGCAGGAGGAGGG - Intergenic
1138233028 16:55353683-55353705 CTGTCTACAAGCCAGGAAGAGGG + Intergenic
1138395101 16:56697997-56698019 CTGCCTACAAGCCAGGAGGATGG - Intronic
1139333889 16:66217089-66217111 ATGCCTATGAGGCAAGAGGATGG - Intergenic
1139572665 16:67823012-67823034 GTGTCTAGAAGGCAAGAGGCTGG + Intronic
1141627954 16:85271319-85271341 ATGTCAAACAGGCAGGAGCGCGG - Intergenic
1141740787 16:85891296-85891318 ATCTCTAAAAGGCAGTAAGTTGG - Intergenic
1143393896 17:6576742-6576764 GGGTCTGAAAGGCAGAAGGAAGG - Intergenic
1143413541 17:6728046-6728068 CTGTCCAGAAGGCAGCAGGAGGG - Intergenic
1143757312 17:9076298-9076320 ATTTCTTAAAGGCAGAGGGATGG + Intronic
1144629869 17:16865547-16865569 CTGTCTGAATGCCAGGAGGAGGG - Intergenic
1144651561 17:17010570-17010592 CTGTCTGAATGCCAGGAGGAGGG + Intergenic
1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG + Intronic
1146521019 17:33525595-33525617 ATGTCTGCAAGGCAGGAGGTAGG - Intronic
1146584676 17:34071908-34071930 ATGTCTAAGTGGAAGGATGAAGG + Intronic
1146663315 17:34679756-34679778 ATGTCTGCATGGCAGGAGGATGG + Intergenic
1148083333 17:44979483-44979505 ATGACTAGAAGGCAGGAGGTTGG + Intergenic
1148731157 17:49837467-49837489 ATGTTTAAAAGGAAGGGGGCGGG - Intergenic
1149071142 17:52544763-52544785 GTGTGTGAAAGGAAGGAGGATGG - Intergenic
1149333108 17:55606808-55606830 ATTTTTAAGAAGCAGGAGGAAGG - Intergenic
1149461356 17:56832687-56832709 GTGTTTAAGAGGGAGGAGGAGGG - Intronic
1149514991 17:57274194-57274216 ATGTGTAAAATGCAGGGTGATGG - Intronic
1151356716 17:73562993-73563015 ATTTCTGGAAGGGAGGAGGAAGG + Intronic
1151939287 17:77282537-77282559 ATGGCCCAAAGGCAGGGGGATGG - Intronic
1152310096 17:79544790-79544812 ATGTCTAGAAGGTGGGGGGAGGG - Intergenic
1152855974 17:82664660-82664682 AGGTTTACAAGGCAGGCGGATGG + Intronic
1155105942 18:22666582-22666604 AAGTCCAAAGGGCAGGAGGAAGG - Intergenic
1156497398 18:37534993-37535015 ATGTCTACATGGCAGGCTGACGG + Intronic
1156816522 18:41317801-41317823 CTGTCTAAATGCCAGGTGGAAGG - Intergenic
1157949254 18:52016325-52016347 ATGGCTTAAAGGCAGGGGGCTGG - Intergenic
1158294141 18:55975771-55975793 AAATCTAAAAGGCAGGCAGAAGG + Intergenic
1158742396 18:60158086-60158108 AGGTCTAAAAGGCGGGGGGGTGG + Intergenic
1159654967 18:71022447-71022469 ATGTCTAAAATGCATCAGCAAGG + Intergenic
1160123643 18:76151546-76151568 GGGTCTTAAAGGCAGGTGGAGGG - Intergenic
1161521246 19:4724529-4724551 ATGTCTAAAAGGCAGGAGGAAGG + Intronic
1161551449 19:4915093-4915115 ATGCCTCAAAGGCAGGATTAAGG + Intronic
1161860691 19:6796065-6796087 ATCTCTAACAGGCAGCAAGAAGG - Intronic
1163667414 19:18609900-18609922 ATGTGTAAGGGGCAGAAGGAGGG + Intronic
1164092144 19:21966258-21966280 AATTCTAAAAAGAAGGAGGAAGG - Intronic
1164479157 19:28598189-28598211 GATTCCAAAAGGCAGGAGGAGGG + Intergenic
1164897554 19:31890459-31890481 ATCTCTCAGAGGCAGGAGGCGGG - Intergenic
1165868543 19:38954023-38954045 TTGTCTAGAAGACAGGAGGAAGG + Intronic
1165973950 19:39658047-39658069 ATGTCTAATTGGCAGGATGGAGG + Intronic
1166655633 19:44609523-44609545 GTGTCTAGAAGGCAGAATGAGGG + Intergenic
1167983152 19:53293111-53293133 ATGTCCAGTAGGCAGGAAGAAGG - Intergenic
1168326577 19:55541530-55541552 AGGTCAAGAAGACAGGAGGAGGG + Intronic
925935596 2:8755842-8755864 ATGTGTCACAGGCATGAGGATGG - Intronic
926241973 2:11095502-11095524 AGGAATAAAAGGCAGGATGAGGG + Intergenic
926783132 2:16494072-16494094 ATGTCAAAAATGCAGAAGCAAGG + Intergenic
926831118 2:16963148-16963170 ATGTCTGAAAGTGAGGAGAATGG + Intergenic
927505639 2:23612216-23612238 AAATCTAAAAAGCAGGTGGAAGG + Intronic
927800144 2:26091271-26091293 AAGTTTAAAAGTCAGGAAGAAGG + Intronic
928571422 2:32613069-32613091 ATGTGTAAAGGCCTGGAGGAGGG - Intronic
929079452 2:38107835-38107857 ATGTTTACATAGCAGGAGGAAGG - Intronic
929895688 2:45958771-45958793 ATGTTTTAAAGGCCAGAGGAAGG - Intronic
930031764 2:47062481-47062503 ATGTCTAAATTGAGGGAGGAAGG - Intronic
931933173 2:67164507-67164529 ATGTCTACAAGCAAGGAAGAGGG + Intergenic
932259695 2:70316919-70316941 ATTTATAAAAGGGAGAAGGAAGG - Intergenic
932338551 2:70944588-70944610 AGGTCTGAAGGGCTGGAGGATGG - Intronic
932734975 2:74248169-74248191 ATGTCTTAAAGGCAGGTAGCTGG + Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933362371 2:81304563-81304585 GTGTCTAAAAGGCAGGTCCAGGG + Intergenic
934743014 2:96739677-96739699 AGGTCTGAAAGGCAGGAGTTAGG - Intronic
935391359 2:102556471-102556493 ATGTCTAAAATTCTGGAGTAAGG - Intergenic
935643036 2:105308689-105308711 ATTTCTGTGAGGCAGGAGGATGG + Intronic
935696797 2:105777270-105777292 AACATTAAAAGGCAGGAGGAAGG - Intronic
936984738 2:118298164-118298186 ATGAATAGAAGGCAGGAGGTTGG - Intergenic
937864087 2:126735057-126735079 ATGACTACAAGGCTGGAGAAAGG - Intergenic
939161604 2:138596605-138596627 AAGTTTAAAAGGCAGTGGGAAGG + Intergenic
941037403 2:160583463-160583485 CTGCATCAAAGGCAGGAGGAGGG - Intergenic
942329392 2:174806113-174806135 ATGTCTTAACTGCAGGGGGAGGG + Intronic
944055409 2:195517407-195517429 ATGTGTAATAGGCAGGAAAATGG - Intergenic
944095106 2:195957319-195957341 ATGTCTCAAATGCCTGAGGAAGG - Exonic
944875180 2:203957049-203957071 AAGACTAAAGGTCAGGAGGAAGG + Intronic
945126449 2:206516518-206516540 TTGTCTATAAGCCAGGAAGAGGG - Intronic
945148453 2:206763332-206763354 ATGTCTAATTGACTGGAGGAGGG - Intronic
946197150 2:218040548-218040570 ATGGTCATAAGGCAGGAGGAGGG - Intronic
946952364 2:224891056-224891078 ATGTCTAGAAGGATGGATGATGG + Intronic
1169281166 20:4268060-4268082 CTGTCTACAAGTCAGGAGGCAGG - Intergenic
1169689580 20:8315591-8315613 ATGTATAAAATGAGGGAGGAAGG + Intronic
1170066442 20:12315839-12315861 ATGTTTACATTGCAGGAGGATGG - Intergenic
1172036146 20:32012022-32012044 ATGCCTCAAAGGCTGGATGAGGG - Intronic
1172874637 20:38156734-38156756 AAGTGTAAAAGGCTGTAGGAAGG - Intronic
1173098125 20:40057543-40057565 CTGTCTACAAGCCAGGAAGAGGG + Intergenic
1173117824 20:40262990-40263012 CTGACTGAAAGGCAGGAGGAAGG - Intergenic
1173702827 20:45088142-45088164 ATTTCTGAAAGACAGGAGGCTGG + Intergenic
1174910376 20:54601672-54601694 ATGATGAAATGGCAGGAGGAGGG + Intronic
1174988617 20:55484486-55484508 ATCTCCAAAAGGCAGGAACATGG - Intergenic
1179242583 21:39605182-39605204 AAGTCTAACAGGCAGGAGGAGGG + Exonic
1179429104 21:41306899-41306921 ATGTCAAATGGGAAGGAGGAAGG - Intronic
1180253083 21:46602599-46602621 CTGTCTAAGAGGCCGGTGGAAGG - Intronic
1181260514 22:21593853-21593875 ATGTTTAAGAGTGAGGAGGAAGG - Intronic
1181330887 22:22089802-22089824 ATCTCTGAAAGACAGGTGGAGGG + Intergenic
1181421530 22:22802682-22802704 ATTTCTCAAAGGCAGGAGAAGGG - Intronic
1181694858 22:24587961-24587983 ATGTATGAATGGCAGGAGGCAGG + Intronic
1181824894 22:25507149-25507171 ATGAATAAAAGGATGGAGGATGG - Intergenic
1181839339 22:25642616-25642638 AACTCCAAAAGGCAGGAGGATGG - Intronic
1183918974 22:41148340-41148362 AACTCTAAAGGGCAGCAGGAGGG - Intronic
949343577 3:3055015-3055037 ATGGCTAAAAGTCAGGATGGTGG - Intronic
950073002 3:10167278-10167300 ATGTCTAAAACTCAGGAAAATGG - Intronic
950096637 3:10334483-10334505 TGGTCTAAAGGGGAGGAGGATGG + Intronic
951593988 3:24297453-24297475 ATTTCTAAATGGCAGGGGCAAGG - Intronic
951754631 3:26076633-26076655 AAGTCTAAAATGCAGGAAGCTGG - Intergenic
952029861 3:29128759-29128781 ATGTGCAAAAGGCAGGGGGTAGG - Intergenic
952894204 3:38065870-38065892 ATTTTTAAAAAGCAGGAGGTGGG - Intronic
954212022 3:49103256-49103278 AGGGATAAAAGGCAGGAAGAGGG - Intronic
955402590 3:58603848-58603870 ATCTGTAAAAAGCAGGAGGTTGG - Intronic
955614078 3:60787275-60787297 ATGTGTAAAAAGCTGGAGCAGGG - Intronic
955980553 3:64521781-64521803 AACTCCAAAAGGGAGGAGGAAGG + Intronic
956716273 3:72082967-72082989 CTGTCTACAAGCCAGGAAGAGGG - Intergenic
957154629 3:76532128-76532150 AGGTCTAATTGGGAGGAGGAAGG - Intronic
959182647 3:103001655-103001677 CTGTATATAAGGCAGGCGGAGGG + Intergenic
959274276 3:104257814-104257836 TTCTCTACAAGGCAGCAGGAAGG - Intergenic
960365640 3:116768583-116768605 ATGTATAGAAGGCTGGATGAGGG + Intronic
960600587 3:119454108-119454130 GTGTCTAAAAAGCAGCAAGAAGG + Intronic
961517195 3:127445270-127445292 ATGTACAAAAGGCCTGAGGATGG + Intergenic
962156281 3:132952194-132952216 ATGTTTTAAAGGCAGCATGAGGG - Intergenic
963004670 3:140715333-140715355 ATGTGGAAAAGGCTGGTGGACGG - Intergenic
963035198 3:141019706-141019728 ATGTCCAAAAAGGAGGAAGAAGG - Intergenic
963254877 3:143134816-143134838 ATGGCTAAAATGCTGCAGGATGG - Intergenic
963594896 3:147314351-147314373 GTGTATAAAATGCAGCAGGAAGG + Intergenic
963969898 3:151418176-151418198 ATGTTTAAATGGCAGTAGGTGGG - Intronic
964247445 3:154669905-154669927 ATGTTGAAGAGGCAGCAGGATGG + Intergenic
964549828 3:157873944-157873966 AAGTCTACAAGGCAGGAAGCAGG - Intergenic
964897165 3:161612584-161612606 ATGTCTACAAGGCACGTCGAAGG + Intergenic
966317471 3:178664207-178664229 ATGTCCACAATGGAGGAGGAGGG + Intronic
966926284 3:184646637-184646659 ATCTCTAGAAGGAAGGAGAAGGG + Intronic
966931286 3:184677449-184677471 ATGTCCAGCAGGCAGGACGATGG - Intronic
967356219 3:188574833-188574855 ATGTGTAAATTTCAGGAGGAGGG - Intronic
968050386 3:195650685-195650707 ATCTGTAAAAGGGAGGAGTAAGG - Intergenic
968096934 3:195938176-195938198 ATCTGTAAAAGGGAGGAGTAAGG + Intergenic
968105442 3:195997670-195997692 ATCTGTAAAAGGGAGGAGTAAGG + Intergenic
968303723 3:197635245-197635267 ATCTGTAAAAGGGAGGAGTAAGG + Intergenic
969145913 4:5123908-5123930 ATCAATAAAAGGCAGGAGGGAGG - Intronic
969459738 4:7322584-7322606 AAGTCGGAAATGCAGGAGGAGGG + Intronic
971514290 4:27467365-27467387 ATATCTAAGAGTCAGGAGAAGGG + Intergenic
972039607 4:34576057-34576079 ATGTGTAAAAGCCAGAAGGATGG - Intergenic
972168128 4:36312006-36312028 ATCTCTAATAGGAAGGAAGATGG + Intronic
972302562 4:37798838-37798860 GTGTCTAAAAGGAAAGAGAAAGG + Intergenic
973099052 4:46239678-46239700 ATGTCCAAATGACAGGAGCATGG - Intergenic
974351302 4:60750435-60750457 ATGTCTAAATTGCAAGTGGAAGG + Intergenic
974886627 4:67826682-67826704 AGGCCAACAAGGCAGGAGGATGG + Intronic
975228950 4:71908177-71908199 GTGAATAAAAGGGAGGAGGAAGG + Intergenic
975528437 4:75376254-75376276 ATGTCTGCAAGGCAGGAAGAGGG - Intergenic
976197004 4:82542549-82542571 GTGGCCAAAAGGCAGGAGGTAGG + Intronic
976221380 4:82759271-82759293 ATATCTTGAAGGCTGGAGGAAGG + Intronic
977434535 4:96976428-96976450 ATAGCTAAAAGGGAGGAGGAAGG - Intergenic
977545653 4:98373339-98373361 ATCTCTTAAAGGCAGCCGGAAGG - Intronic
978988313 4:115044677-115044699 ATGAGTAAAAGTCAGCAGGAAGG + Intronic
979552766 4:122009700-122009722 AGGACTAAGAGGCAGGAGGAGGG + Intergenic
979835404 4:125360734-125360756 ATGTCTTTAGGGGAGGAGGATGG + Intronic
979969696 4:127118978-127119000 GAGTTTTAAAGGCAGGAGGAGGG - Intergenic
980159911 4:129148265-129148287 ATTTCCAAAAGGGAGGAAGAAGG + Intergenic
983329066 4:166301319-166301341 ATGTTTAAAAGGAATGAGTAGGG + Intergenic
985372962 4:189306763-189306785 ATTTTTAAAAGGAAGCAGGAAGG + Intergenic
985835529 5:2269391-2269413 TTGTTTTAAAGGCAGGATGATGG + Intergenic
986846711 5:11764566-11764588 ATGTCCAAAAGCCAGGAGTTAGG - Intronic
986969580 5:13316247-13316269 ATGTGAAAAAGGCATGAGAAGGG + Intergenic
988506266 5:31826150-31826172 ATGGATAAAAGGCAGGAGACAGG - Intronic
991021794 5:61987055-61987077 TTGTCTGCAAGGCAGGAAGAGGG + Intergenic
991369262 5:65901213-65901235 AGATCTAAAAGGCAGGAGTTGGG - Intergenic
991476792 5:67029786-67029808 ATGTGAAAAAGGTAGGAGAAAGG + Intronic
992069666 5:73137046-73137068 AAGTTTAATAGGCAGAAGGAAGG + Intergenic
992738351 5:79746241-79746263 TTTTCTAAAGGGTAGGAGGATGG - Intronic
993619870 5:90155643-90155665 ATGTCTACAAAGCAGGACCATGG + Intergenic
994016741 5:94975452-94975474 CTGTCTACAAGCCAGGAGGCAGG + Intronic
995006272 5:107199769-107199791 ATATATAAAAGGAAGGAAGAGGG + Intergenic
995603407 5:113823854-113823876 AAGACTAGAAGGCTGGAGGAGGG + Intergenic
996507563 5:124285454-124285476 GTCTTTAAAAAGCAGGAGGAGGG + Intergenic
996826138 5:127683418-127683440 ATGTCAATAAGTTAGGAGGAGGG + Intergenic
996943871 5:129043320-129043342 ATTTCTAAATGTCAGCAGGATGG + Intergenic
997382947 5:133450418-133450440 ATGGCTAAAAGGAAGCAGCAGGG - Intronic
997789143 5:136741176-136741198 AGGTGTAAAAGGCATGTGGATGG - Intergenic
998160516 5:139810396-139810418 ATGTCTAGAAGGCACCAGGGTGG + Intronic
998511842 5:142720332-142720354 GTGGCGATAAGGCAGGAGGAAGG + Intergenic
999880069 5:155852559-155852581 ATGTCAAAGAAGTAGGAGGATGG + Intergenic
1000117413 5:158166534-158166556 AAGACAAAAAGGCAGGAAGAGGG + Intergenic
1000157881 5:158569650-158569672 ATGCCTAGTAGACAGGAGGAGGG - Intergenic
1000430235 5:161143116-161143138 ATATCTATCAGGCAGGAGGGAGG + Intergenic
1000690908 5:164319751-164319773 ATGTATAAAAGGAGGGAGGCAGG - Intergenic
1002403717 5:179011923-179011945 ATGACAAAAATCCAGGAGGATGG + Intergenic
1005127984 6:22470730-22470752 ATGTCCCAGAAGCAGGAGGAAGG + Intergenic
1006890519 6:37423715-37423737 AAGTTTAATAGGCAGGAGAAAGG + Intergenic
1007375129 6:41451334-41451356 CTGTGGAAAAGGCAGGAGGGAGG - Intergenic
1008155391 6:48008089-48008111 ATTTCTAAGTGGCAGCAGGAAGG + Intronic
1009361536 6:62820536-62820558 TTGTCTAGAAGCCAGGAGGAGGG - Intergenic
1009820987 6:68800875-68800897 CTATCTAAATGGGAGGAGGAAGG + Intronic
1010530117 6:76958471-76958493 AAATCTTAAAGGCAGGAGGGTGG + Intergenic
1011444348 6:87422021-87422043 GTGTTTAAAAGGTAGGGGGAAGG + Intronic
1012932547 6:105331971-105331993 AAATCCAAAAGGCAGGAGAATGG + Intronic
1012985500 6:105871561-105871583 ATATCAAAAAGGAAAGAGGATGG - Intergenic
1015367354 6:132411463-132411485 ATGTGTAAAAATCAGGACGAGGG + Intergenic
1018325762 6:162666171-162666193 ATGTCTATAAGAAAAGAGGAGGG + Intronic
1018736053 6:166688059-166688081 GTATTCAAAAGGCAGGAGGAGGG + Intronic
1021125259 7:16844735-16844757 ATGTCCAAAAGGAAGGAGAAAGG - Intergenic
1022540910 7:31134782-31134804 ATGTTTAAATGGGATGAGGAAGG - Intergenic
1022905930 7:34856825-34856847 ATGATTGAGAGGCAGGAGGAGGG + Intronic
1023696718 7:42855214-42855236 AAGTCAAAAAGGCATGAAGACGG - Intergenic
1023812676 7:43924544-43924566 ATGTCAATAATGTAGGAGGATGG + Intronic
1027229980 7:76267129-76267151 ATGGTGAAAAGGCAGGTGGAGGG + Intronic
1027251038 7:76398857-76398879 GTGTTTAAGGGGCAGGAGGATGG + Intronic
1028791808 7:94861967-94861989 CTGTCTGCAAGCCAGGAGGAGGG - Intergenic
1029088060 7:98026716-98026738 ATCTTTAAAAGGAAGGGGGAAGG - Intergenic
1029846061 7:103413526-103413548 ATATCTAAGAGTCAGGAGGAGGG - Intronic
1029954349 7:104621889-104621911 GTTACTAAAAGGCAGGAAGATGG - Intronic
1030228999 7:107185599-107185621 ATGTCTAAAATGTGTGAGGAGGG + Intronic
1030278205 7:107742983-107743005 AAGTGTAAAAGGCTGGAGAAAGG + Intergenic
1030411055 7:109180813-109180835 AAGTCTAAAATGCAGTGGGATGG - Intergenic
1031174012 7:118325787-118325809 ATTTTAAAAAGGCAGGAGAAAGG + Intergenic
1032347059 7:131126148-131126170 ATGTACAAAAGGCAGGAGAAGGG + Intronic
1032928338 7:136636172-136636194 ATGTTTAAAAGGCAAGAGAATGG - Intergenic
1032981069 7:137283852-137283874 ATGTGTATGAGGGAGGAGGATGG - Intronic
1033633479 7:143184883-143184905 GTGTTTAAAAGGCATGTGGAGGG - Intergenic
1034859586 7:154583975-154583997 ATATCCCAAAGGCAGGGGGATGG - Intronic
1036607317 8:10319000-10319022 ATGTCTCAAAGGCTGGATCAAGG - Intronic
1036731572 8:11270184-11270206 GTGTCTGAAATGCAGGAGGCAGG - Intergenic
1037024587 8:14018532-14018554 ATGTCCAACAGCTAGGAGGAAGG - Intergenic
1037070892 8:14647556-14647578 ATGTCTAAAACACATGAAGAAGG - Intronic
1037454893 8:19053225-19053247 ACGTCTTAAAGGCAGGTGGTGGG + Intronic
1038002873 8:23405311-23405333 AGTTATCAAAGGCAGGAGGAGGG + Intronic
1038048248 8:23785368-23785390 CTGCCTAAAAAGCAGGAGTATGG - Intergenic
1038817480 8:30919912-30919934 CTGTCTGTAAGCCAGGAGGAGGG + Intergenic
1039195955 8:35031819-35031841 GTGTCTAGAAGGCAGGATGAGGG + Intergenic
1040396327 8:47003889-47003911 ATGTCCAAAAAGCAGAAGGTTGG - Intergenic
1042062805 8:64839627-64839649 ATTCCTAAAAGGCAGGATGATGG - Intergenic
1042230902 8:66553377-66553399 ATGAGTAAAAGGCTGGAGAATGG - Intergenic
1042294061 8:67201257-67201279 ATGTCTAACATGCAGGACAAAGG - Intronic
1043930282 8:86082674-86082696 AAGGCTGAAAGGCAGGAGGATGG + Intronic
1044077813 8:87845330-87845352 CTGTCTATAAGTCAGGAGGATGG - Intergenic
1044872740 8:96635897-96635919 ATGACTAATAGGCAGTATGAGGG + Intergenic
1047108359 8:121760254-121760276 ATATCTGAAATTCAGGAGGATGG + Intergenic
1047711194 8:127554169-127554191 AGGTATAGAAGGCAGGAGGTGGG - Intergenic
1048054789 8:130853051-130853073 ATCTCTCCAAGGAAGGAGGAAGG + Intronic
1048412816 8:134193240-134193262 AATTCTAAAAAGCAGCAGGATGG + Intergenic
1048625737 8:136183021-136183043 ATGGATGAAAGGCACGAGGAAGG + Intergenic
1049342493 8:142120689-142120711 ATCTCTAAAATGCAGGTTGAGGG - Intergenic
1049617327 8:143581325-143581347 AGCTCTGCAAGGCAGGAGGAGGG + Exonic
1049653097 8:143784835-143784857 ATGTCTAGAAGGTGGAAGGACGG + Intergenic
1050594701 9:7194025-7194047 ATGTCTGAAAGCCAAGAGCAGGG - Intergenic
1050681437 9:8116356-8116378 GTCTCTAGAAGGCAGGATGAGGG + Intergenic
1051798779 9:20907480-20907502 ATGTCCAGAAGGCAGCAGGATGG - Intronic
1052715829 9:32116035-32116057 CTGACTAAAAGGCAGGATAAAGG - Intergenic
1053663077 9:40298070-40298092 ATGGGTAAAAGGCAGGAGTGGGG + Intronic
1054375203 9:64444294-64444316 ATGGGTAAAAGGCAGGAGTGGGG + Intergenic
1054521539 9:66078215-66078237 ATGGGTAAAAGGCAGGAGTGGGG - Intergenic
1054784245 9:69195554-69195576 ATGTGAAAAAAGCAGGAGTAGGG + Intronic
1054829241 9:69605112-69605134 ATTTTTAAAGGGCAGGAGAAAGG - Intronic
1055221349 9:73936015-73936037 ATAACGAAAAGGCAGGAGGTAGG - Intergenic
1055739088 9:79366185-79366207 ATGACTGAAAGGGAGGATGAGGG + Intergenic
1055778108 9:79788582-79788604 AAGACTTAAAGGCAGGAAGAAGG + Intergenic
1056301284 9:85244424-85244446 AGGACTAGAAGGCAGGAGGATGG + Intergenic
1056349789 9:85738749-85738771 ATGTTTCCAAGGCAGGAGGCAGG + Intronic
1056498511 9:87185089-87185111 ATGTCTAAAATGTAGGAGTCGGG - Intergenic
1058099833 9:100906984-100907006 ATTACTAAAAAGTAGGAGGAGGG + Intergenic
1058339529 9:103877737-103877759 CTGTCTGTAAGCCAGGAGGAGGG - Intergenic
1058785221 9:108380475-108380497 AGGTCTAATGGGCTGGAGGAAGG - Intergenic
1058929347 9:109703668-109703690 TTCTCTAAAAGACAGGGGGATGG + Intronic
1059387975 9:113979960-113979982 ATGTTTACAAGACAGGAGAAAGG + Intronic
1059408800 9:114118964-114118986 ATCTCTATATGGTAGGAGGAGGG + Intergenic
1059633246 9:116147456-116147478 AAATCTAAAATACAGGAGGAAGG + Intergenic
1060839068 9:126780177-126780199 TTGTCTATGAGACAGGAGGAGGG + Intergenic
1186177641 X:6942043-6942065 GACTCCAAAAGGCAGGAGGAGGG + Intergenic
1186315298 X:8363126-8363148 ATGGATAAAAGGCAGGAGACTGG + Intergenic
1186335477 X:8582472-8582494 AAGTCTAAGAGGAAGGAGAAAGG + Intronic
1187535654 X:20139602-20139624 ATTTCCAAAAGGCAGGAAAAAGG + Intronic
1188491280 X:30741047-30741069 AAGTCTAATAGGCAGAAGAAAGG - Intergenic
1188550745 X:31361990-31362012 ATGGTTAAAAGATAGGAGGATGG - Intronic
1188643329 X:32534218-32534240 CTGTCTACAAGCCAGGAAGAAGG - Intronic
1189128136 X:38469692-38469714 CTGTCTAAAAAGCAGGAGTTTGG - Intronic
1191853955 X:65607762-65607784 ATGTTTGAAAGACAGGAGGCAGG + Intronic
1193859983 X:86653379-86653401 ATGTCTAAAAGCGTGGTGGAAGG + Intronic
1194133283 X:90107870-90107892 ATAGCAAAAAGGCAGAAGGAGGG + Intergenic
1194746043 X:97629439-97629461 ATGTTTAAAAGGCTGCAGGTAGG - Intergenic
1195468471 X:105207828-105207850 ATGTTTAGAAGGCAAGAAGAAGG + Intronic
1196310900 X:114163880-114163902 ATGGATAAAAGGCAAGATGAAGG - Intergenic
1198405769 X:136311038-136311060 CTGTCTACAAGCCAGGAAGAGGG - Intronic
1199137776 X:144273327-144273349 CTGTCTGAAAGTCAGGAAGAAGG - Intergenic
1199558992 X:149142682-149142704 TTGTCTGAAAGGCTGGAGGGTGG - Intergenic
1200479067 Y:3677952-3677974 ATAGCAAAAAGGCAGAAGGAGGG + Intergenic
1201428075 Y:13875822-13875844 AAGTCTAAGAGGAAGGAGAAAGG - Intergenic
1201670948 Y:16519370-16519392 ATGATTGGAAGGCAGGAGGATGG - Intergenic
1201941650 Y:19466778-19466800 TTGTCTTACAGGAAGGAGGAGGG - Intergenic