ID: 1161521922

View in Genome Browser
Species Human (GRCh38)
Location 19:4729480-4729502
Sequence AGCAAGAAAGGGGGCACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161521922_1161521928 0 Left 1161521922 19:4729480-4729502 CCCTCAGTGCCCCCTTTCTTGCT No data
Right 1161521928 19:4729503-4729525 CAAAAGTGTGTTGATTGACCAGG No data
1161521922_1161521929 8 Left 1161521922 19:4729480-4729502 CCCTCAGTGCCCCCTTTCTTGCT No data
Right 1161521929 19:4729511-4729533 TGTTGATTGACCAGGCGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161521922 Original CRISPR AGCAAGAAAGGGGGCACTGA GGG (reversed) Intergenic