ID: 1161521922 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:4729480-4729502 |
Sequence | AGCAAGAAAGGGGGCACTGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1161521922_1161521929 | 8 | Left | 1161521922 | 19:4729480-4729502 | CCCTCAGTGCCCCCTTTCTTGCT | No data | ||
Right | 1161521929 | 19:4729511-4729533 | TGTTGATTGACCAGGCGCAGCGG | No data | ||||
1161521922_1161521928 | 0 | Left | 1161521922 | 19:4729480-4729502 | CCCTCAGTGCCCCCTTTCTTGCT | No data | ||
Right | 1161521928 | 19:4729503-4729525 | CAAAAGTGTGTTGATTGACCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1161521922 | Original CRISPR | AGCAAGAAAGGGGGCACTGA GGG (reversed) | Intergenic | ||