ID: 1161521928

View in Genome Browser
Species Human (GRCh38)
Location 19:4729503-4729525
Sequence CAAAAGTGTGTTGATTGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161521920_1161521928 2 Left 1161521920 19:4729478-4729500 CCCCCTCAGTGCCCCCTTTCTTG No data
Right 1161521928 19:4729503-4729525 CAAAAGTGTGTTGATTGACCAGG No data
1161521923_1161521928 -1 Left 1161521923 19:4729481-4729503 CCTCAGTGCCCCCTTTCTTGCTC No data
Right 1161521928 19:4729503-4729525 CAAAAGTGTGTTGATTGACCAGG No data
1161521921_1161521928 1 Left 1161521921 19:4729479-4729501 CCCCTCAGTGCCCCCTTTCTTGC No data
Right 1161521928 19:4729503-4729525 CAAAAGTGTGTTGATTGACCAGG No data
1161521919_1161521928 5 Left 1161521919 19:4729475-4729497 CCACCCCCTCAGTGCCCCCTTTC No data
Right 1161521928 19:4729503-4729525 CAAAAGTGTGTTGATTGACCAGG No data
1161521915_1161521928 18 Left 1161521915 19:4729462-4729484 CCGGTTTATGCCCCCACCCCCTC No data
Right 1161521928 19:4729503-4729525 CAAAAGTGTGTTGATTGACCAGG No data
1161521914_1161521928 19 Left 1161521914 19:4729461-4729483 CCCGGTTTATGCCCCCACCCCCT No data
Right 1161521928 19:4729503-4729525 CAAAAGTGTGTTGATTGACCAGG No data
1161521925_1161521928 -10 Left 1161521925 19:4729490-4729512 CCCCTTTCTTGCTCAAAAGTGTG No data
Right 1161521928 19:4729503-4729525 CAAAAGTGTGTTGATTGACCAGG No data
1161521917_1161521928 7 Left 1161521917 19:4729473-4729495 CCCCACCCCCTCAGTGCCCCCTT No data
Right 1161521928 19:4729503-4729525 CAAAAGTGTGTTGATTGACCAGG No data
1161521924_1161521928 -9 Left 1161521924 19:4729489-4729511 CCCCCTTTCTTGCTCAAAAGTGT No data
Right 1161521928 19:4729503-4729525 CAAAAGTGTGTTGATTGACCAGG No data
1161521922_1161521928 0 Left 1161521922 19:4729480-4729502 CCCTCAGTGCCCCCTTTCTTGCT No data
Right 1161521928 19:4729503-4729525 CAAAAGTGTGTTGATTGACCAGG No data
1161521918_1161521928 6 Left 1161521918 19:4729474-4729496 CCCACCCCCTCAGTGCCCCCTTT No data
Right 1161521928 19:4729503-4729525 CAAAAGTGTGTTGATTGACCAGG No data
1161521916_1161521928 8 Left 1161521916 19:4729472-4729494 CCCCCACCCCCTCAGTGCCCCCT No data
Right 1161521928 19:4729503-4729525 CAAAAGTGTGTTGATTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161521928 Original CRISPR CAAAAGTGTGTTGATTGACC AGG Intergenic