ID: 1161521929

View in Genome Browser
Species Human (GRCh38)
Location 19:4729511-4729533
Sequence TGTTGATTGACCAGGCGCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161521921_1161521929 9 Left 1161521921 19:4729479-4729501 CCCCTCAGTGCCCCCTTTCTTGC No data
Right 1161521929 19:4729511-4729533 TGTTGATTGACCAGGCGCAGCGG No data
1161521923_1161521929 7 Left 1161521923 19:4729481-4729503 CCTCAGTGCCCCCTTTCTTGCTC No data
Right 1161521929 19:4729511-4729533 TGTTGATTGACCAGGCGCAGCGG No data
1161521920_1161521929 10 Left 1161521920 19:4729478-4729500 CCCCCTCAGTGCCCCCTTTCTTG No data
Right 1161521929 19:4729511-4729533 TGTTGATTGACCAGGCGCAGCGG No data
1161521926_1161521929 -3 Left 1161521926 19:4729491-4729513 CCCTTTCTTGCTCAAAAGTGTGT No data
Right 1161521929 19:4729511-4729533 TGTTGATTGACCAGGCGCAGCGG No data
1161521927_1161521929 -4 Left 1161521927 19:4729492-4729514 CCTTTCTTGCTCAAAAGTGTGTT No data
Right 1161521929 19:4729511-4729533 TGTTGATTGACCAGGCGCAGCGG No data
1161521915_1161521929 26 Left 1161521915 19:4729462-4729484 CCGGTTTATGCCCCCACCCCCTC No data
Right 1161521929 19:4729511-4729533 TGTTGATTGACCAGGCGCAGCGG No data
1161521925_1161521929 -2 Left 1161521925 19:4729490-4729512 CCCCTTTCTTGCTCAAAAGTGTG No data
Right 1161521929 19:4729511-4729533 TGTTGATTGACCAGGCGCAGCGG No data
1161521919_1161521929 13 Left 1161521919 19:4729475-4729497 CCACCCCCTCAGTGCCCCCTTTC No data
Right 1161521929 19:4729511-4729533 TGTTGATTGACCAGGCGCAGCGG No data
1161521917_1161521929 15 Left 1161521917 19:4729473-4729495 CCCCACCCCCTCAGTGCCCCCTT No data
Right 1161521929 19:4729511-4729533 TGTTGATTGACCAGGCGCAGCGG No data
1161521918_1161521929 14 Left 1161521918 19:4729474-4729496 CCCACCCCCTCAGTGCCCCCTTT No data
Right 1161521929 19:4729511-4729533 TGTTGATTGACCAGGCGCAGCGG No data
1161521914_1161521929 27 Left 1161521914 19:4729461-4729483 CCCGGTTTATGCCCCCACCCCCT No data
Right 1161521929 19:4729511-4729533 TGTTGATTGACCAGGCGCAGCGG No data
1161521916_1161521929 16 Left 1161521916 19:4729472-4729494 CCCCCACCCCCTCAGTGCCCCCT No data
Right 1161521929 19:4729511-4729533 TGTTGATTGACCAGGCGCAGCGG No data
1161521922_1161521929 8 Left 1161521922 19:4729480-4729502 CCCTCAGTGCCCCCTTTCTTGCT No data
Right 1161521929 19:4729511-4729533 TGTTGATTGACCAGGCGCAGCGG No data
1161521924_1161521929 -1 Left 1161521924 19:4729489-4729511 CCCCCTTTCTTGCTCAAAAGTGT No data
Right 1161521929 19:4729511-4729533 TGTTGATTGACCAGGCGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161521929 Original CRISPR TGTTGATTGACCAGGCGCAG CGG Intergenic