ID: 1161525123

View in Genome Browser
Species Human (GRCh38)
Location 19:4749701-4749723
Sequence GGGTTTTTTGAGACAGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161525123_1161525130 28 Left 1161525123 19:4749701-4749723 CCAGACCCTGTCTCAAAAAACCC No data
Right 1161525130 19:4749752-4749774 AAAAAAAAAGACTGTAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161525123 Original CRISPR GGGTTTTTTGAGACAGGGTC TGG (reversed) Intergenic
No off target data available for this crispr