ID: 1161525124

View in Genome Browser
Species Human (GRCh38)
Location 19:4749706-4749728
Sequence TTGTGGGGTTTTTTGAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4628
Summary {0: 5, 1: 13, 2: 89, 3: 902, 4: 3619}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161525124_1161525130 23 Left 1161525124 19:4749706-4749728 CCCTGTCTCAAAAAACCCCACAA 0: 5
1: 13
2: 89
3: 902
4: 3619
Right 1161525130 19:4749752-4749774 AAAAAAAAAGACTGTAGAAAAGG No data
1161525124_1161525131 28 Left 1161525124 19:4749706-4749728 CCCTGTCTCAAAAAACCCCACAA 0: 5
1: 13
2: 89
3: 902
4: 3619
Right 1161525131 19:4749757-4749779 AAAAGACTGTAGAAAAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161525124 Original CRISPR TTGTGGGGTTTTTTGAGACA GGG (reversed) Intergenic
Too many off-targets to display for this crispr