ID: 1161525125

View in Genome Browser
Species Human (GRCh38)
Location 19:4749707-4749729
Sequence TTTGTGGGGTTTTTTGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3907
Summary {0: 4, 1: 12, 2: 81, 3: 815, 4: 2995}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161525125_1161525130 22 Left 1161525125 19:4749707-4749729 CCTGTCTCAAAAAACCCCACAAA 0: 4
1: 12
2: 81
3: 815
4: 2995
Right 1161525130 19:4749752-4749774 AAAAAAAAAGACTGTAGAAAAGG No data
1161525125_1161525131 27 Left 1161525125 19:4749707-4749729 CCTGTCTCAAAAAACCCCACAAA 0: 4
1: 12
2: 81
3: 815
4: 2995
Right 1161525131 19:4749757-4749779 AAAAGACTGTAGAAAAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161525125 Original CRISPR TTTGTGGGGTTTTTTGAGAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr