ID: 1161525128

View in Genome Browser
Species Human (GRCh38)
Location 19:4749723-4749745
Sequence CTTTTGTTTTTTGGCTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161525128_1161525132 17 Left 1161525128 19:4749723-4749745 CCACAAAAGCCAAAAAACAAAAG No data
Right 1161525132 19:4749763-4749785 CTGTAGAAAAGGACAGGACACGG No data
1161525128_1161525131 11 Left 1161525128 19:4749723-4749745 CCACAAAAGCCAAAAAACAAAAG No data
Right 1161525131 19:4749757-4749779 AAAAGACTGTAGAAAAGGACAGG No data
1161525128_1161525130 6 Left 1161525128 19:4749723-4749745 CCACAAAAGCCAAAAAACAAAAG No data
Right 1161525130 19:4749752-4749774 AAAAAAAAAGACTGTAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161525128 Original CRISPR CTTTTGTTTTTTGGCTTTTG TGG (reversed) Intergenic
No off target data available for this crispr