ID: 1161525129

View in Genome Browser
Species Human (GRCh38)
Location 19:4749732-4749754
Sequence TTTTTTTGTCTTTTGTTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42800
Summary {0: 2, 1: 66, 2: 508, 3: 15880, 4: 26344}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161525129_1161525131 2 Left 1161525129 19:4749732-4749754 CCAAAAAACAAAAGACAAAAAAA 0: 2
1: 66
2: 508
3: 15880
4: 26344
Right 1161525131 19:4749757-4749779 AAAAGACTGTAGAAAAGGACAGG No data
1161525129_1161525130 -3 Left 1161525129 19:4749732-4749754 CCAAAAAACAAAAGACAAAAAAA 0: 2
1: 66
2: 508
3: 15880
4: 26344
Right 1161525130 19:4749752-4749774 AAAAAAAAAGACTGTAGAAAAGG No data
1161525129_1161525132 8 Left 1161525129 19:4749732-4749754 CCAAAAAACAAAAGACAAAAAAA 0: 2
1: 66
2: 508
3: 15880
4: 26344
Right 1161525132 19:4749763-4749785 CTGTAGAAAAGGACAGGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161525129 Original CRISPR TTTTTTTGTCTTTTGTTTTT TGG (reversed) Intergenic
Too many off-targets to display for this crispr