ID: 1161525130

View in Genome Browser
Species Human (GRCh38)
Location 19:4749752-4749774
Sequence AAAAAAAAAGACTGTAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161525124_1161525130 23 Left 1161525124 19:4749706-4749728 CCCTGTCTCAAAAAACCCCACAA 0: 5
1: 13
2: 89
3: 902
4: 3619
Right 1161525130 19:4749752-4749774 AAAAAAAAAGACTGTAGAAAAGG No data
1161525125_1161525130 22 Left 1161525125 19:4749707-4749729 CCTGTCTCAAAAAACCCCACAAA 0: 4
1: 12
2: 81
3: 815
4: 2995
Right 1161525130 19:4749752-4749774 AAAAAAAAAGACTGTAGAAAAGG No data
1161525129_1161525130 -3 Left 1161525129 19:4749732-4749754 CCAAAAAACAAAAGACAAAAAAA 0: 2
1: 66
2: 508
3: 15880
4: 26344
Right 1161525130 19:4749752-4749774 AAAAAAAAAGACTGTAGAAAAGG No data
1161525126_1161525130 8 Left 1161525126 19:4749721-4749743 CCCCACAAAAGCCAAAAAACAAA No data
Right 1161525130 19:4749752-4749774 AAAAAAAAAGACTGTAGAAAAGG No data
1161525123_1161525130 28 Left 1161525123 19:4749701-4749723 CCAGACCCTGTCTCAAAAAACCC No data
Right 1161525130 19:4749752-4749774 AAAAAAAAAGACTGTAGAAAAGG No data
1161525127_1161525130 7 Left 1161525127 19:4749722-4749744 CCCACAAAAGCCAAAAAACAAAA No data
Right 1161525130 19:4749752-4749774 AAAAAAAAAGACTGTAGAAAAGG No data
1161525128_1161525130 6 Left 1161525128 19:4749723-4749745 CCACAAAAGCCAAAAAACAAAAG No data
Right 1161525130 19:4749752-4749774 AAAAAAAAAGACTGTAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161525130 Original CRISPR AAAAAAAAAGACTGTAGAAA AGG Intergenic
No off target data available for this crispr