ID: 1161525131

View in Genome Browser
Species Human (GRCh38)
Location 19:4749757-4749779
Sequence AAAAGACTGTAGAAAAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161525128_1161525131 11 Left 1161525128 19:4749723-4749745 CCACAAAAGCCAAAAAACAAAAG No data
Right 1161525131 19:4749757-4749779 AAAAGACTGTAGAAAAGGACAGG No data
1161525126_1161525131 13 Left 1161525126 19:4749721-4749743 CCCCACAAAAGCCAAAAAACAAA No data
Right 1161525131 19:4749757-4749779 AAAAGACTGTAGAAAAGGACAGG No data
1161525124_1161525131 28 Left 1161525124 19:4749706-4749728 CCCTGTCTCAAAAAACCCCACAA 0: 5
1: 13
2: 89
3: 902
4: 3619
Right 1161525131 19:4749757-4749779 AAAAGACTGTAGAAAAGGACAGG No data
1161525127_1161525131 12 Left 1161525127 19:4749722-4749744 CCCACAAAAGCCAAAAAACAAAA No data
Right 1161525131 19:4749757-4749779 AAAAGACTGTAGAAAAGGACAGG No data
1161525129_1161525131 2 Left 1161525129 19:4749732-4749754 CCAAAAAACAAAAGACAAAAAAA 0: 2
1: 66
2: 508
3: 15880
4: 26344
Right 1161525131 19:4749757-4749779 AAAAGACTGTAGAAAAGGACAGG No data
1161525125_1161525131 27 Left 1161525125 19:4749707-4749729 CCTGTCTCAAAAAACCCCACAAA 0: 4
1: 12
2: 81
3: 815
4: 2995
Right 1161525131 19:4749757-4749779 AAAAGACTGTAGAAAAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161525131 Original CRISPR AAAAGACTGTAGAAAAGGAC AGG Intergenic
No off target data available for this crispr